Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

ACRA

The ACRA group of genes confer resistance to Drug and biocide resistance through the mechanism, Drug and biocide RND efflux pump.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Drug and biocide RND efflux pumps

    Sequences

    Download Sequences

    >>MEG_399|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|ACRA
    ATGAACAAAAACAGAGGGTTTACGCCTCTGGCGGTCGTTCTGATGCTCTCAGGCAGCTTAGCCCTAACAGGATGTGACGA
    CAAACAGGCCCAACAAGGTGGCCAGCAGATGCCCGCCGTTGGCGTAGTAACAGTCAAAACTGAACCTCTGCAGATCACAA
    CCGAGCTTCCGGGTCGCACCAGTGCCTACCGGATCGCAGAAGTTCGTCCTCAAGTTAGCGGGATTATCCTGAAGCGTAAT
    TTCAAAGAAGGTAGCGACATCGAAGCAGGTGTCTCTCTCTATCAGATTGATCCTGCGACCTATCAGGCGACATACGACAG
    TGCGAAAGGTGATCTGGCGAAAGCCCAGGCTGCAGCCAATATCGCGCAATTGACGGTGAATCGTTATCAGAAACTGCTCG
    GTACTCAGTACATCAGTAAGCAAGAGTACGATCAGGCTCTGGCTGATGCGCAACAGGCGAATGCTGCGGTAACTGCGGCG
    AAAGCTGCCGTTGAAACTGCGCGGATCAATCTGGCTTACACCAAAGTCACCTCTCCGATTAGCGGTCGCATTGGTAAGTC
    GAACGTGACGGAAGGCGCATTGGTACAGAACGGTCAGGCGACTGCGCTGGCAACCGTGCAGCAACTTGATCCGATCTACG
    TTGATGTGACCCAGTCCAGCAACGACTTCCTGCGCCTGAAACAGGAACTGGCGAATGGCACGCTGAAACAAGAGAACGGC
    AAAGCCAAAGTGTCACTGATCACCAGTGACGGCATTAAGTTCCCGCAGGACGGTACGCTGGAATTCTCTGACGTTACCGT
    TGATCAGACCACTGGGTCTATCACCCTACGCGCTATCTTCCCGAACCCGGATCACACTCTGCTGCCGGGTATGTTCGTGC
    GCGCACGTCTGGAAGAAGGGCTTAATCCAAACGCTATTTTAGTCCCGCAACAGGGCGTAACCCGTACGCCGCGTGGCGAT
    GCCACCGTACTGGTAGTTGGCGCGGATGACAAAGTGGAAACCCGTCCGATCGTTGCAAGCCAGGCTATTGGCGATAAGTG
    GCTGGTGACAGAAGGTCTGAAAGCAGGCGATCGCGTAGTAATAAGTGGGCTGCAGAAAGTGCGTCCTGGTGTCCAGGTAA
    AAGCACAAGAAGTTACCGCTGATAATAACCAGCAAGCCGCAAGCGGTGCTCAGCCTGAACAGTCCAAGTCTTAA

    >>MEG_400|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|ACRA
    ATGAACAAAAACAGAGGGTTAACGCCTCTGGCGGTCGTTCTGATGCTCTCAGGCAGCTTAGCGCTAACAGGATGTGACGA
    TAAACCGGCTCAACAGGGAGCCCAGCACATGCCGGAAGTCGGTATTGTGACGCTCAAATCCGCACCTCTACAAATAACCA
    CCGAACTGCCAGGCCGCACCAGCGCCTATCGCATTGCGGAAGTCCGTCCTCAGGTCAGTGGCATTATTTTAAAACGTAAC
    TTCGTGGAAGGTAGCGATATCCAGGCCGGCGTCTTCCTGTATCAGATCGATCCAGCCACCTATCAAGGCAGCTATGACAG
    CGCCAAAGGCGACCTGGCAAAAGCCCAGGCGGCGGCAAACATGGATCAACTGACGGTCAAGCGTTATCAGAAACTGTTGG
    GCACCCAATATATTAGTCAACAAGACTACGATCCCGCCGTTGCGACGGCGCAACAAAACAATGCCGCCGTGGTCGCGGCG
    AAAACTGCCGTTGAAACCGCGCGCATCAATTTGGCCTACACCCAAAAGTCACCTCTCCGATCAGCGGCCGGATCGGGTAA
    ATCCCCCGTGACCGAAGGGGCGTTGGTACAGAATGGTCAAACGACCGCCTTGGCAACCGTTCAGCAAGTGGATCCGATCT
    ATGTTGACGTCACCCAGTCGAGCAATGATTTCCTGCGCCTGAAGCAGGAGCTAGCCGACGCCCGCCTGAAACAGGAAAAC
    GGCAAAGCGAAAGTGGAGCTGGTGACTAATGACGGGCTTAAGTATCCGCAGTCCGGCACGCTGGAATTCTCGGATGTCAC
    CGTCGATCAGACCACCGGCTCAATCACGCTACGCGCTATTTTCCCGAACCCGGATCACACCCTGCTTCCGGGGATGTTCG
    TCCGTGCCCGTCTGGAAGAAGGGATTAACCCTGACGCCCTGCTGGTACCGCAACAGGGTGTTACCCGTACGCCGCGCGGC
    GACGCCAGCGTCATGGTAGTGGGTGAAGGCGATAAAGTCGAAGTCCGCCAGGTCACTGCTTCTCAGGCGATCGGCGATAA
    ATGGCTGGTCACTGACGGTCTGAAATCCGGCGATCGCGTTATCGTCACCGGCCTGCAAAAAATCAAACCAGGTGTGCAGG
    TAAAAGCGCAGGAAGTAGCTTCTGATGATAAACAGCAAGCCGCAGGCAACGCGCCATCAGAACAAACCAAGTCTTAA