MEGAResFrom MEG, the Microbial Ecology Group

EMRR

The emrR gene encodes a transcriptional regulator that affects expression of the EmrAB efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Other Groups in Drug and biocide MFS efflux regulator

Sequences

Download Sequences

>MEG_2734|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_regulator|EMRR
ATGGATAGTTCGTTTACGCCCATTGAACAAATGCTAAAATTTCGCGCCAGCCGCCACGAAGATTTTCCTTATCAGGAGAT
CCTTCTGACTCGTCTTTGCATGCACATGCAAAGCAAGCTGCTGGAGAACCGCAATAAAATGCTGAAGGCTCAGGGGATTA
ACGAGACGTTGTTTATGGCGTTGATTACGCTGGAGTCTCAGGAAAACCACAGTATTCAGCCTTCTGAATTAAGTTGTGCT
CTTGGATCATCCCGTACCAACGCGACGCGTATTGCCGATGAACTGGAAAAACGCGGTTGGATCGAACGTCGTGAAAGCGA
TAACGATCGCCGCTGCCTGCATCTGCAATTAACGGAAAAAGGTCACGAGTTTTTGCGCGAGGTTTTACCACCGCAGCATA
ACTGCCTGCATCAACTCTGGTCCGCGCTCAGCACAACAGAAAAAGATCAGCTCGAGCAAATCACCCGCAAATTGCTCTCC
CGTCTCGACCAGATGGAACAAGACGGTGTGGTTCTCGAAGCGATGAGCTAA