MEGAResFrom MEG, the Microbial Ecology Group

NORA

The norA gene encodes a multi-drug efflux pump that, when overexpressed, can act effectively on fluoroquinolones, therefore causing resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC89076/

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_4206|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|NORA
CAGCTGACAAGGTAAATTATTCACCTAAAGATATTTCGATTGCTATTACGGGTGGCGGTATATTTGGGGCACTTTTCCAA
ATCTATTTCTTCGATAAATTTGTGAAGTATTTCTCAGAGTTAACATTTATAGCTTGGTCATTATTATATTCAGTTGTTGT
CTTAATATTATTAGTTTTTGCTAATGGCTATTGGTCAATAATGTTAATCAGTTTTGTTGTCTTCATAGGTTTTGATATGA
TACGACCAGCCATTACAAATTATTTTTCTAATATTGCTGGAGAAAGGCAAGGCTTTGCAGGCGGATTGAACTCGACATTC
ACTAGTATGGGTAATTTCATAGGTCCTTTAATCGCAGGTGCGTTATTTGATGTACACATTGAAGCACCAATTTATATGGA
TATAGGTGTTTCATTAGCAGGTGTTGTTATTGTTTTAATTGAAAAGCAACATAGAGCAAAATTGAAAGAACAAAATATGT
AG

>>MEG_4207|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|NORA
ATGAATAAACAGATTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTAGTAATACCAGTCTTGCC
TGTTTATTTAAAAGATTTGGGATTAACTGGTAGTGATTTAGGATTACTAGTTGCTGCTTTTGCGTTATCTCAAATGATTA
TATCGCCGTTTGGTGGTACGCTAGCTGACAAATTAGGGAAGAAATTAATTATATGTATAGGATTAATTTTGTTTTCAGTG
TCAGAATTTATGTTTGCAGTTGGCCACAATTTTTCGGTATTGATGTTATCGAGAGTGATTGGTGGTATGAGTGCTGGTAT
GGTAATGCCTGGTGTGACAGGTTTAATAGCTGACATTTCACCAAGCCATCAAAAAGCAAAAAACTTTGGCTACATGTCAG
CGATTATCAATTCTGGATTCATTTTAGGACCAGGGATTGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTAC
TTTGCAGGAGCATTAGGTATTCTAGCATTTATAATGTCAATTGTATTGATTCACGATCCGAAAAAGTCTACGACAAGTGG
TTTCCAAAAGTTAGAGCCACAATTGCTAACGAAAATTAACTGGAAAGTGTTTATTACACCAGTTATTTTAACACTTGTAT
TATCGTTTGGTTTATCTGCATTTGAAACATTGTATTCACTATACACAGCTGACAAGGTAAATTATTCACCTAAAGATATT
TCGATTGCTATTACGGGTGGCGGTATATTTGGGGCACTTTTCCAAATCTATTTCTTCGATAAATTTATGAAGTATTTCTC
AGAGTTAACATTTATAGCTTGGTCATTATTATATTCAGTTGTTGTCTTAATATTATTAGTTTTTGCTAATGGCTATTGGT
CAATAATGTTAATCAGTTTTGTTGTCTTCATAGGTTTTGATATGATACGACCAGCCATTACAAATTATTTTTCTAATATT
GCTGGAGAAAGGCAAGGCTTTGCAGGCGGATTGAACTCGACATTCACTAGTATGGGTAATTTCATAGGTCCTTTAATCGC
AGGTGCGTTATTTGATGTACACATTGAAGCACCAATTTATATGGCTATAGGTGTTTCATTAGCAGGTGTTGTTATTGTTT
TAATTGAAAAGCAACATAGAGCAAAATTGAAAGAACAAAATATGTAG

>>MEG_4208|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|NORA
ATGAAAAAACAATTATTCATTCTTTATTTTAATATATTTCTTATATTTTTAGGGATTGGATTAGTTATTCCTGTACTTCC
TGTATATTTGAAGGATTTAGGATTAAAAGGTAGTGACTTAGGAATGCTAGTTGCTGCTTTTGCATTATCACAAATGATTA
TTTCACCATTTGGTGGGACACTAGCTGATAAATTGGGTAAAAAATTAATTATATGTATCGGTTTAGTATTCTTTGCTGTC
TCTGAATTTATGTTCGCAGCCGGTCAAAGTTTTACCATTTTAATCATTTCACGTGTTTTAGGTGGCTTTAGTGCAGGCAT
GGTCATGCCTGGTGTAACAGGTATGATTGCAGATATTTCTCCAGGAGCTGATAAAGCTAAAAACTTTGGTTACATGTCGG
CAATTATTAATTCAGGTTTTATATTAGGACCTGGATTTGGAGGCTTTTTAGCTGAAATTTCACATAGATTACCTTTCTAT
GTTGCTGGAACATTAGGTGTTGTTGCATTCATTATGTCAGTTTTATTAATTCATAATCCTCAAAAAGCAACTACAGATGG
ATTCCACCAATATCAACCTGAATTATTCACTAAAATTAATTGGAAAGTATTTATTACTCCAGTCATATTAACACTTGTAT
TAGCATTTGGTTTATCTGCTTTTGAAACATTATTTTCTTTATATACAGCTGACAAAGTAAATTATACTCCTAAAGATATT
TCGATAGCTATTATCGGTGGAGGCGTGTTTGGCGCATTATTCCAAGTATTCTTCTTTGATAAATTTATGAAATATATGAG
TGAACTTAATTTTATTGCATGGTCATTACTATATTCAGCCATTGTTCTCGTTATGTTAGTGCTTGCAAACGGTTATTGGA
CGATTATGATTATTAGCTTTGTTGTTTTTATAGGTTTTGATATGATTAGACCAGCTTTAACCAATTACTTCTCGAATATA
GCAGGCAAACGGCAAGGTTTTGCAGGTGGATTGAATTCAACTTTTACCAGTATGGGTAACTTTATAGGTCCTCTTGTAGC
TGGTGCATTATTCGATGTTAATTTAGAGTTTCCTTTATATATGGCTATTGCGGTTTCATTAAGTGGAATTATCATTATTT
TTATTGAAAAAGGACTTAAGTCACGCCGTAAAGAAGCAAATTAA

>>MEG_4209|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|NORA
ATGAATAAACAGATTTTGGTATTATATTTTAATATTTTCTTAATTTTTTTAGGTATCGGTCTAGTGATACCAGTCTTACC
TGTTTATTTAAAAGATTTGGGGTTAACTGGTAGTGATTTAGGATTATTAGTTGCTGCTTTCGCCTTATCTCAAATGATTA
TATCGCCATTCGGTGGTACGTTAGCTGATAAATTAGGAAAGAAATTAATTATATGTATAGGATTAATTTTGTTTTCAGTG
TCAGAATTTATGTTTGCTATCGGTCAGAATTTTTTAATTTTGATGTTATCAAGGGTTATCGGTGGTATGAGTGCTGGTAT
GGTTATGCCTGGGGTGACAGGTTTAATAGCTGATATTTCACCAAGCCATCAAAAAGCAAAAAACTTTGGCTACATGTCAG
CGATTATCAATTCAGGATTCATTTTAGGACCAGGGATTGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTAT
TTTGCAGGTGCATTAGGTATTCTAGCATTTATAATGTCAATTGTATTGATTCACGACCCTAAAAAAGTTTCGACAAATGG
ATTCCAAAAGTTGGAGCCACAATTGCTAACGAAAATTAACTGGAAAGTGTTTATTACACCAGTTATTCTAACACTTGTAT
TATCGTTTGGTTTATCTGCATTTGAAACATTGTATTCACTATACACAGCTGACAAGGTAAATTATTCACCTAAAGATATT
TCGATTGCAATTACAGGTGGCGGTATCTTTGGTGCACTTTTCCAAATTTATTTCTTTGATAAATTTATGAAATACTTCTC
TGAGTTAACATTTATTGCATGGTCATTAATATATTCAGTTATTGTATTAGTGCTATTAGTTATTGCCGATGGTTACTGGA
CAATTATGGTAATAAGCTTTGTTGTCTTTATCGGGTTCGATATGATAAGACCTGCTATTACAAATTATTTTTCAAATATT
GCTGGTGATAGACAGGGATTTGCAGGTGGGTTAAACTCAACATTCACTAGCATGGGGAATTTTATAGGTCCTTTAATCGC
AGGTGCGTTATTTGATGTGCACATTGAAGCCCCAATTTATATGGCTATAGGTGTGTCATTAGCTGGTGTTGTCATTGTTT
TAATTGAAAAGCAACATAGAGCTAAGTTAAAACAACAAGATTTGTAA