MEGAResFrom MEG, the Microbial Ecology Group

MDFA

The mdfA gene encodes a putative membrane protein that is part of a major facilitator superfamily efflux system in Escherichia coli.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC178964/

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_3736|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDFA
ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATT
TTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGG
TTCCTACTTCGATGACCGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGT
CGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTGCTGGCGCAAAACATTGAACA
ATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCT
TCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGG
TCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC
TGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGGCGCTGGCGCTGCGGATTCGTTAGTCTGCCGTTGCTGGCGTGGATCG
CCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGG
GGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCT
GGCCGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGG
TTAAGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTCCGATTAACCCTGTTTGCCAGCGATATGAGTAA
AGGTACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGC
TGAACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTA
AAAGATAAACAGATGGGAAATTCTCACGAAGGGTAA

>>MEG_3737|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDFA
ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATT
TTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGG
TTCCTACTTCGATGACCGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGT
CGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTGCTGGCGCAAAACATTGAACA
ATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCT
TCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGG
TCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC
TGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGTCTGCCGTTGCTGGCGTGGATCGCC
CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGC
GTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGC
CGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGGTTA
AGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG
TACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGA
ACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA
GATAAACAGATGGGAAATTCTCACGAAGGGTAA

>>MEG_3738|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDFA
ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTCCCTCTCTGTCTGGTGCTTTACGAATT
TTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATTGATTGGG
TTCCTACTTCGATGAACGCGTATCTGGCGGGCGGGATGTTTTTACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGT
CGCCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTGCTGGCGCAAAACATTGAACA
ATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCT
TCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
GGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGG
TCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC
TGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCGTTAGTCTGCCGTTGCTGGCGTGGATCGCC
CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGC
GTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGC
CGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGGTTA
AGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGG
TACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGA
ACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTTAAAA
GATAAACAGATGGGAAATTCTCACGAAGGGTAA

>>MEG_3739|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDFA
ATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTTTCCTCTCTGTCTGGTGCTTTACGAATT
TTCAACCTATATCGGCAACGATATGAGGCAACCCGGTATGTTGGAAAATGTGGAACAATATCAGGCGGGCATTGAGTGGG
TTCCTACTTCGATGAACGCGTATCTGGCGGGCGGGATGTTTATACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGT
CGTCGTCCGGTGATGCTGGCGGGAGTGGTGTGGTTTATCGTCACATGTCTGGCAATATTGCTGGCGCAAAACATTGAACA
ATTCACCCTGTTGCGCTTCTTGCACGGCATAAGCCTCTGTTTCATTGGCGCTGTGGGATACGACGCAATTCAGGAATCCT
TCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGATTGCTCCGCTACTTGGTCCGCTGGTG
GGCGCGTCGTGGATCCATGTGCTGCCCTGGGAGGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTTTTCGG
TCTGCAACGGGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGC
TGGTGCTGAAGAACGGCCGCTTTGTGGCGGGGGCGCTGGCGCTGGGATTCCTTAGTCTGCCGTTGCTGGCGTGGATCGCC
CAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGAGCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGC
GTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTCGCTGATTATTATGGGCGGCTGGC
CGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGGTTA
AGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGTTATGAGTAAAGG
TACGGTTTCTGCCGCGATGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGA
ACGGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTCAACGGAATTTTGTTGCTGTCGCTGATGGTTATCTTTTTAAAA
GATAAACAGATGGGAAATTCTCACGAAGGGTAA