MEGAResFrom MEG, the Microbial Ecology Group

FEXA

The fexA gene encodes a chloramphenicol efflux pump.

References

  • http://onlinelibrary.wiley.com/doi/10.1016/j.femsre.2004.04.001/pdf

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_2901|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|FEXA
atgaaaaaggatagtaaatctaaagaaatgattcaatctgaaaaaaggggttctactaggcttttaatgatggtactctc
cctatctgtacttgtaggtgcaattacggctgatttagtcaatcccgtacttccactaataagcaaagatttagaagctt
cgaaatctcaagtgagttggatagttagtggtattgcacttgttcttgcgattggagttccgatttatggtcgaatctca
gacttttttgagttacgaaagctatatatctttgccattatgattctggcaagtggtagtcttttatgtgcaattgcccc
gaacctcccattgttggttttgggaagaatggttcagggtgctgggatgtccgcaattccagttctatcaatcattgcaa
tttcgaaggttttcccacaaggaaaacgtgggggagctttgggaattatcgcaggaagtattggtgttggaactgctgct
ggtccaatatttggtggagtagttggtcaatatttagggtggaatgccttgttttggtccacatttttgttagccattat
gattgttattggtgcctactacgcgttaccgacaattaaaccggcagaatccgtaggaagcaataagaactttgatttca
ttggtggtttattcctcggcctcacagtaggattactcctttttggcatcactcaaggagaaacttctggtttttcttcg
ttctcatcgttaactagcctaattggttctgttgtagctttggtgggatttatttggagaattgttaccgcagaaaatcc
atttgtaccacctgtcctgttcaataacaaggattatgtcaatacggtcataattgcatttttttcgatgtttgcttatt
tcgctgttcttgtgttcgtcccattactagtcgttgaggtgaatggactctcttctggacaggctggaatgatattgttg
ccaggtggtgtggctgttgcaatcttatctcccttcgttggccgtctttctgatcgatttggggataaacgtctgataat
tactgggatgactctgatggggctgtctaccttattcttgtccacctatgcatctggtgcttcacctctgttagtttccg
tgggggtcctcggagtagggattgcttttgcattcacgaattctcccgcaaataacgccgcagtaagtgcactcgatgca
gacaaggttggtgtcggaatggggattttccaaggtgctttgtaccttggagcaggaactggagcaggtatgattggagc
attattatccgctcgacgtgatgctactgagccgataaatccattatatatattggacgctatgtcctactcagatgcgt
tccttgcagctacaggggcaatactcattgccttaatagctggattaggtttaaaaaagcgtgggtaa

>>MEG_2902|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|FEXA
atgaaaaaggatagtaaatctaaagaaatgattcaatctgaaaaaaggggttctactaggcttttaatgatggtactctc
cctatctgtacttgtaggtgcaattacggctgatttagtcaatcccgtacttccactaataagcaaagatttagaagctt
cgaaatctcaagtgagttggatagttagtggtattgcacttgttcttgcgattggagttccgatttatggtcgaatctca
gacttttttgagttacgaaagctatatatctttgccattatgattctggcaagtggtagtcttttatgtgcaattgcccc
gaacctcccattgttggttttgggaagaatggttcagggtgctgggatgtccgcaattccagttctatcagtcattgcaa
tttcgaaggttttcccacaaggaaaacgtgggggagctttgggaattatcgcaggaagtattggtgttggaactgctgct
ggtccaatatttggtggagtagttggtcaatatttagggtggaatgccttgttttggttcacatttttgttagccattat
gattgttattggtgcctactacgcgttaccgacaattaaaccggcagaatccgtaggaagcaataagaactttgatttca
ttggtggtttattcctcggcctcacagtaggattactcctttttggcatcactcaaggagaaacttctggtttttcttcg
ttctcatcgttaactagcctaattggttctgttgtagctttggtgggatttatttggagaattgttaccgcagaaaatcc
atttgtaccacctgtcctgttcaataacaaggattatgtcaatacggtcataattgcatttctttcgatgtttgcttatt
tcgctgttcttgtgttcgtcccattactagtcgttgaggtgaatggactctcttctggacaggctggaatgatattgttg
ccaggtggtgtggctgttgcaatcttatctcccttcgttggccgtctttctgatcgatttggggataaacgtctgataat
tactgggatgactctgatggggctgtctaccttattcttgtccacctatgcatctggtgcttcacctctgttagtttccg
tgggggtcctcggagtagggattgcttttgcattcacgaattctcccgcaaataacgccgcagtaagtgcactcgatgca
gacaaggttggtgtcggaatggggattttccaaggtgctttgtaccttggagcaggaactggagcaggtatgattggagc
attattatccgctcgacgtgatgctactgagccgataaatccattatatatattggacgctatgtcctactcagatgcgt
tccttgcagctacaggggcaatactcattgccttaatagctggattaggtttaaaaaagcgtgggtaa

>>MEG_2903|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|FEXA
ATGAAAAAGGATAGTAAATCTAAAGAAATGATTCAATCTGAAAAAAGGGGTTCTACTAGGCTTTTAATGATGGTACTCTC
CCTATCTGTACTTGTAGGTGCAATTACGGCTGATTTAGTCAATCCCGTACTTCCACTAATAAGCAAAGATTTAGAAGCTT
CGAAATCTCAAGTGAGTTGGATAGTTAGTGGTATTGCACTTGTTCTTGCGATTGGAGTTCCGATTTATGGTCGAATCTCA
GACTTTTTTGAGTTACGAAAGCTATATATCTTTGCCATTATGATTCTGGCAAGTGGTAGTCTTTTATGTGCAATTGCCCC
GAACCTCCCATTGTTGGTTTTGGGAAGAATGGTTCAGGGTGCTGGGATGTCCGCAATTCCAGTTCTATCAGTCATTGCAA
TTTCGAAGGTTTTCCCACAAGGAAAACGTGGGGGAGCTTTGGGAATTATCGCAGGAAGTATTGGTGTTGGAACTGCTGCT
GGTCCAATATTTGGTGGAGTAGTTGGTCAATATTTAGGGTGGAATGCCTTGTTTTGGTTCACATTTTTGTTAGCCATTAT
GATTGTTATTGGTGCCTACTACGCGTTACCGACAATTAAACCGGCAGAATCCGTAGGAAGCAATAAGAACTTTGATTTCA
TTGGTGGTTTATTCCTCGGCCTCACAGTAGGATTACTCCTTTTTGGCATCACTCAAGGAGAAACTTCTGGTTTTTCTTCG
TTCTCATCGTTAACTAGCCTAATTGGTTCTGTTGTAGCTTTGGTGGGATTTATTTGGAGAATTGTTACCGCAGAAAATCC
ATTTGTACCACCTGTCCTGTTCAATAACAAGGATTATGTCAATACGGTCATAATTGCATTTTTTTCGATGTTTGCTTATT
TCGCTGTTCTTGTGTTCGTCCCATTACTAGTCGTTGAGGTGAATGGACTCTCTTCTGGACAGGCTGGAATGATATTGTTG
CCAGGTGGTGTGGCTGTTGCAATCTTATCTCCCTTCGTTGGCCGTCTTTCTGATCGATTTGGGGATAAACGTCTGATAAT
TACTGGGATGACTCTGATGGGGCTGTCTACCTTATTCTTGTCCACCTATGCATCTGGTGCTTCACCTCTGTTAGTTTCCG
TGGGGGTCCTCGGAGTAGGGATTGCTTTTGCATTCACGAATTCTCCCGCAAATAACGCCGCAGTAAGTGCACTCGATGCA
GACAAGGTTGGTGTCGGAATGGGGATTTTCCAAGGTGCTTTGTACCTTGGAGCAGGAACTGGAGCAGGTATGATTGGAGC
ATTATTATCCGCTCGACGTGATGCTACTGAGCCGATAAATCCATTATATATATTGGACGCTATGTCCTACTCAGATGCGT
TCCTTGCAGCTACAGGGGCAATACTCATTGCCTTAATAGCTGGATTAGGTTTAAAAAAGCGTGGGTAA

>>MEG_2904|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|FEXA
ATGAAAAAGGATAGTAAATCTAAAGAAATGATTCAATCTGAAAAAAGGGGTTCTACTAGGCTTTTAATGATGGTACTCTC
CCTATCTGTACTTGTAGGTGCAATTACGGCTGATTTAGTCAATCCCGTACTTCCACTAATAAGCAAAGATTTAGAAGCTT
CGAAATCTCAAGTGAGTTGGATAGTTAGTGGTATTGCACTTGTTCTTGCGATTGGAGTTCCGATTTATGGTCGAATCTCA
GACTTTTTTGAGTTACGAAAGCTATATATCTTTGCCATTATGATTCTGGCAAGTGGTAGTCTTTTATGTGCAATTGCCCC
GAACCTCCCATTGTTGGTTTTGGGAAGAATGGTTCAGGGTGCTGGGATGTCCGCAATTCCAGTTCTATCAATCATTGCAA
TTTCGAAGGTTTTCCCACAAGGAAAACGTGGGGGAGCTTTGGGAATTATCGCAGGAAGTATTGGTGTTGGAACTGCTGCT
GGTCCAATATTTGGTGGAGTAGTTGGTCAATATTTAGGGTGGAATGCCTTGTTTTGGTTCACATTTTTGTTAGCCATTAT
GATTGTTATTGGTGCCTACTACGCGTTACCGACAATTAAACCGGCAGAATCCGTAGGAAGCAATAAGAACTTTGATTTCA
TTGGTGGTTTATTCCTCGGCCTCACAGTAGGATTACTCCTTTTTGGCATCACTCAAGGAGAAACTTCTGGTTTTTCTTCG
TTCTCATCGTTAACTAGCCTAATTGGTTCTGTTGTAGCTTTGGTGGGATTTATTTGGAGAATTGTTACCGCAGAAAATCC
ATTTGTACCACCTGTCCTGTTCAATAACAAGGATTATGTCAATACGGTCATAATTGCATTTTTTTCGATGTTTGCTTATT
TCGCTGTTCTTGTGTTCGTCCCATTACTAGTCGTTGAGGTGAATGGACTCTCTTCTGGACAGGCTGGAATGATATTGTTG
CCAGGTGGTGTGGCTGTTGCAATCTTATCTCCCTTCGTTGGCCGTCTTTCTGATCGATTTGGGGATAAACGTCTGATAAT
TACTGGGATGACTCTGATGGGGCTGTCTACCTTATTCTTGTCCACCTATGCATCTGGTGCTTCACCTCTGTTAGTTTCCG
TGGGGGTCCTCGGAGTAGGGATTGCTTTTGCATTCACGAATTCTCCCGCAAATAACGCCGCAGTAAGTGCACTCGATGCA
GACAAGGTTGGTGTCGGAATGGGGATTTTCCAAGGTGCTTTGTACCTTGGAGCAGGAACTGGAGCAGGTATGATTGGAGC
ATTATTATCCGCTCGACGTGATGCTACTGAGCCGATAAATCCATTATATATATTGGACGCTATGTCCTACTCAGATGCGT
TCCTTGCAGCTACAGGGGCAATACTCATTGCCTTAATAGCTGGATTAGGTTTAAAAAAGCGTGGGTAA

>>MEG_2905|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|FEXA
AGGAGGAAATAAAATGAAAAAGGATAGTAAATCTAAAGAAATGATTCAATCTGAAAAAAGGGGTTCTACTAGGCTTTTAA
TGATGGTACTCTCCCTATCTGTACTTGTAGGTGCAATTACGGCTGATTTAGTCAATCCCGTACTTCCACTAATAAGCAAA
GATTTAGAAGCTTCGAAATCTCAAGTGAGTTGGATAGTTAGTGGTATTGCACTTGTTCTTGCGATTGGAGTTCCGATTTA
TGGTCGAATCTCAGACTTTTTTGAGTTACGAAAGCTATATATCTTTGCCATTATGATTCTGGCAAGTGGTAGTCTTTTAT
GTGCAATTGCCCCGAACCTCCCATTGTTGGTTTTGGGAAGAATGGTTCAGGGTGCTGGGATGTCCGCAATTCCAGTTCTA
TCAATCATTGCAATTTCGAAGGTTTTCCCACAAGGAAAACGTGGGGGAGCTTTGGGAATTATCGCAGGAAGTATTGGTGT
TGGAACTGCTGCTGGTCCAATATTTGGTGGAGTAGTTGGTCAATATTTAGGGTGGAATGCCTTGTTTTGGTTCACATTTT
TGTTAGCCATTATGATTGTTATTGGTGCCTACTACGCGTTACCGACAATTAAACCGGCAGAATCCGTAGGAAGCAATAAG
AACTTTGATTTCATTGGTGGTTTATTCCTCGGCCTCACAGTAGGATTACTCCTTTTTGGCATCACTCAAGGAGAAACTTC
TGGTTTTTCTTCGTTCTCATCGTTAACTAGCCTAATTGGTTCTGTTGTAGCTTTGGTGGGATTTATTTGGAGAATTGTTA
CCGCAGAAAATCCATTTGTACCACCTGTCCTGTTCAATAACAAGGATTATGTCAATACGGTCATAATTGCATTTTTTTCG
ATGTTTGCTTATTTCGCTGTTCTTGTGTTCGTCCCATTACTAGTCGTTGAGGTGAATGGACTCTCTTCTGGACAGGCTGG
AATGATATTGTTGCCAGGTGGTGTGGCTGTTGCAATCTTATCTCCCTTCGTTGGCCGTCTTTCTGATCGATTTGGGGATA
AACGTCTGATAATTACTGGGATGACTCTGATGGGGCTGTCTACCTTATTCTTGTCCACCTATGCATCTGGTGCTTCACCT
CTGTTAGTTTCCGTGGGGGTCCTCGGAGTAGGGATTGCTTTTGCATTCACGAATTCTCCCGCAAATAACGCCGCAGTAAG
TGCACTCGATGCAGACAAGGTTGGTGTCGGAATGGGGATTTTCCAAGGTGCTTTGTACCTTGGAGCAGGAACTGGAGCAG
GTATGATTGGAGCATTATTATCCGCTCGACGTGATGCTACTGAGCCGATAAATCCATTATATATATTGGACGCTATGTCC
TACTCAGATGCGTTCCTTGCAGCTACAGGGGCAATACTCATTGCCTTAATAGCTGGATTAGGTTTAAAAAAGCGTGGGTA
A