MEGAResFrom MEG, the Microbial Ecology Group

BLT

The blt gene encodes a multi-drug efflux system under regulation of BltR.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_1463|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|BLT
ATGAAAAAATCAATAAATGAGCAAAAAACGATATTCATTATACTATTAAGCAACATCTTCGTAGCATTTCTTGGTATCGG
TTTAATCATTCCAGTTATGCCTTCTTTTATGAAAATCATGCATTTATCCGGCAGCACAATGGGTTATCTTGTTGCGGCTT
TTGCCATTTCTCAGTTAATTACTTCACCTTTTGCAGGTAGGTGGGTTGACCGTTTCGGGAGAAAAAAAATGATTATTCTC
GGGTTGCTTATATTCAGTTTATCTGAGTTGATTTTCGGATTAGGGACCCATGTTTCAATATTTTATTTCTCGAGGATATT
GGGTGGTGTAAGTGCGGCTTTTATCATGCCCGCGGTAACAGCATATGTAGCTGATATTACAACCCTAAAGGAAAGGTCAA
AGGCTATGGGGTATGTTTCTGCTGCAATTAGCACCGGCTTTATTATTGGACCTGGTGCGGGAGGATTTATTGCCGGCTTT
GGTATCCGCATGCCGTTTTTCTTCGCCTCCGCCATCGCGTTAATAGCAGCTGTCACTTCCGTTTTTATACTAAAAGAGTC
ATTGTCGATAGAAGAACGCCATCAACTCTCATCTCATACAAAGGAATCAAATTTCATTAAAGACTTGAAGAGATCCATTC
ATCCTGTCTATTTCATTGCATTTATTATCGTCTTTGTAATGGCTTTTGGTTTATCAGCTTATGAAACGGTATTCAGCTTG
TTTTCTGATCATAAATTTGGCTTCACACCAAAAGATATTGCAGCCATTATTACGATTAGTTCCATTGTTGCGGTAGTTAT
TCAAGTTTTACTATTCGGGAAATTGGTCAACAAACTTGGAGAGAAAAGAATGATTCAGCTGTGCTTAATAACCGGTGCGA
TCTTGGCTTTCGTGTCTACTGTTATGTCAGGATTTTTAACTGTTTTGCTTGTAACTTGTTTTATTTTTCTGGCGTTCGAT
TTGCTACGTCCGGCCTTAACCGCTCATTTATCCAATATGGCCGGTAACCAGCAGGGTTTCGTAGCAGGCATGAACTCCAC
ATACACCAGCCTGGGAAATATATTTGGACCTGCTCTAGGCGGTATACTATTTGATCTTAACATTCATTATCCTTTCCTTT
TTGCAGGTTTCGTTATGATTGTCGGCCTTGGTCTTACAATGGTTTGGAAAGAAAAAAAGAATGATGCTGCAGCTTTGAAT
TAA

>>MEG_1464|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|BLT
TTGACTATACGGTAACCATATACCTTATGATTTGATTGTACTTGAAAAAAGCTTCAAGCGAAAAGGATAGGTAAAAAGGG
TTCAATTGAGTAAAAGGGGAATTCAGATGAAAAAATCAATAAATGAGCAAAAAACGATATTCATTATACTATTAAGCAAC
ATCTTCGTAGCATTTCTTGGTATCGGTTTAATCATTCCAGTTATGCCTTCTTTTATGAAAATCATGCATTTATCCGGCAG
CACAATGGGTTATCTTGTTGCGGCTTTTGCCATTTCTCAGTTAATTACTTCACCTTTTGCAGGTAGGTGGGTTGACCGTT
TCGGGAGAAAAAAAATGATTATTCTCGGGTTGCTTATATTCAGTTTATCTGAGTTGATTTTCGGATTAGGGACCCATGTT
TCAATATTTTATTTCTCGAGGATATTGGGTGGTGTAAGTGCGGCTTTTATCATGCCCGCGGTAACAGCATATGTAGCTGA
TATTACAACCCTAAAGGAAAGGTCAAAGGCTATGGGGTATGTTTCTGCTGCAATTAGCACCGGCTTTATTATTGGACCTG
GTGCGGGAGGATTTATTGCCGGCTTTGGTATCCGCATGCCGTTTTTCTTCGCCTCCGCCATCGCGTTAATAGCAGCTGTC
ACTTCCGTTTTTATACTAAAAGAGTCATTGTCGATAGAAGAACGCCATCAACTCTCATCTCATACAAAGGAATCAAATTT
CATTAAAGACTTGAAGAGATCCATTCATCCTGTCTATTTCATTGCATTTATTATCGTCTTTGTAATGGCTTTTGGTTTAT
CAGCTTATGAAACGGTATTCAGCTTGTTTTCTGATCATAAATTTGGCTTCACACCAAAAGATATTGCAGCCATTATTACG
ATTAGTTCCATTGTTGCGGTAGTTATTCAAGTTTTACTATTCGGGAAATTGGTCAACAAACTTGGAGAGAAAAGAATGAT
TCAGCTGTGCTTAATAACCGGTGCGATCTTGGCTTTCGTGTCTACTGTTATGTCAGGATTTTTAACTGTTTTGCTTGTAA
CTTGTTTTATTTTTCTGGCGTTCGATTTGCTACGTCCGGCCTTAACCGCTCATTTATCCAATATGGCCGGTAACCAGCAG
GGTTTCGTAGCAGGCATGAACTCCACATACACCAGCCTGGGAAATATATTTGGACCTGCTCTAGGCGGTATACTATTTGA
TCTTAACATTCATTATCCTTTCCTTTTTGCAGGTTTCGTTATGATTGTCGGCCTTGGTCTTACAATGGTTTGGAAAGAAA
AAAAGAATGATGCTGCAGCTTTGAATTAA