MEGAResFrom MEG, the Microbial Ecology Group

TETH

The tetH gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_7094|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTTAA

>MEG_7095|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAAGCGATTAA

>MEG_7096|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGGGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>MEG_7097|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGTTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA

>MEG_7098|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETH
ATGAATAAATCAATTATTATTATACTGCTGATCACCGTATTAGATGCCATTGGTATCGGGCTTATCATGCCAGTACTCCC
TACTCTATTAAATGAATTTGTCAGTGAAAATTCACTGGCAACCCATTACGGTGTGCTATTAGCGCTCTATGCTACCATGC
AGGTTATTTTTGCTCCTATTCTAGGACGACTGTCTGATAAATACGGCAGAAAACCCATCTTGCTGTTTTCCCTTTTAGGC
GCGGCACTCGACTATCTTTTAATGGCATTCTCAACCACACTTTGGATGCTCTATATTGGGCGCATCATTGCGGGGATCAC
AGGCGCAACAGGTGCCGTATGTGCATCAGCGATGAGTGATGTGACTCCCGCTAAAAATCGAACTCGCTATTTTGGTTTCT
TAGGTGGTGCTTTTGGTGTTGGCCTTATTATCGGCCCAATGCTAGGGGGATTATTAGGTGATATCAGTGCTCATATGCCA
TTTATTTTTGCCGCTATTTCACACTCGATATTATTAATACTCTCTTTGCTCTTTTTCCGAGAAACACAAAAAAGAGAAGC
GCTTGTTGCCAATAGGACACCTGAAAACCAAACTGCCTCAAATACAGTCACTGTTTTTTTTAAGAAAAGCCTCTACTTTT
GGTTAGCAACCTATTTTATTATCCAGCTTATCGGGCAAATTCCTGCCACCATCTGGGTGCTGTTTACACAATATCGTTTT
GATTGGAACACAACTTCTATCGGTATGTCTTTGGCGGTTCTGGGTGTATTACATATTTTCTTTCAGGCGATTGTCGCTGG
GAAATTGGCACAAAAATGGGGCGAAAAAACCACCATTATGATCAGTATGTCTATTGATATGATGGGCTGTTTATTATTAG
CGTGGATAGGCCACGTTTGGGTCATCTTACCAGCATTAATTTGCTTAGCGGCAGGAGGTATGGGGCAACCCGCATTACAA
GGTTATTTATCAAAATCTGTCGATGATAATGCGCAAGGGAAATTACAAGGTACTCTGGTGAGCCTAACCAATATTACCGG
GATCATTGGTCCCCTTTTATTTGCCTTTATTTATAGTTATAGCGTCGCTTATTGGGATGGTCTGTTATGGCTGATGGGGG
CAATACTTTATGCTATGTTGCTTATTACCGCTTATTTTCACCAAAGAAAAACCACACCTAAAGCTGTTATTTCAACCCCT
TAA