MEGAResFrom MEG, the Microbial Ecology Group

TETG

The tetG gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_7088|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETG
gtgcgcagctctgccatcattgccctgctgatcgtggggctcgacgccatgggtctcggcctcatcatgcccgtccttcc
gacgcttctgcgtgagcttgtgccagcagagcaggtcgccggtcactatggtgccttgctgtcgctctatgcattgatgc
aggtcgtcttcgcacccgtgcttggacagctttcggattcttacggtcggcgtccggtgcttctggcttcccttgcggga
gccgcagtcgattatgcgattatggcatcagcgccggtcttatgggtgctctatatcggccgactcgtctccggcatcac
gggcgcaaccggagctgtagctgcctcaaccattgccgattcgacgggggaaggttctcgcgcacgctggttcggctaca
tgggggcctgttatggggcgggcatgattgccgggccagcacttggtggcatgctcggtggtatctctgctcatgcccca
tttatcgccgccgcccttctcaacgggttcgcgttcctgcttgcctgcattttcctcagggagacccgtcgcggtcatgg
caagaccggaaagccggttcgtatccaaccatttgttctattccggctggacgatgtgttgcgtgggttgactgctcttt
tcgccgttttcttcattattcaactgatcggccaagtgcctgcggccctatgggttatatatggcgaggatcgttttcag
tggaacaccgcgaccgttggtttgtcgctcgcggcgtttggggcaacacatgcgatcttccaagcgtttgttaccggccc
gctttcaagccggcttggagagcggcgcacgctactgtttggcatggctgcggatgcgactggcttcgttcttctggctt
ttgccacgcagggatggatggtgttcccgattctgttgctgcttgccgccgggggtgttggcatgccggccttgcaagca
atgctctcaaacaatgtcagcagtaacaagcaaggggctttgcagggaacgctaacgagcctcaccaatctaagctctat
cgcaggaccgcttggcttcacagcactctattctgccaccgccggagcatggaacggttgggtttggattgtcggcgcga
tcctctatttaatatgtctgccaatactacgcagaccattcgcaacttcattgtga

>MEG_7089|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTGGGTCTTGACGCCATGGGTCTCGGCCTCATCATGCCCGTCCTTCC
GACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTATGGTGCCTTGCTGTCGCTCTATGCATTGATGC
AGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTCGGCGTCCGGTACTTCTGGCTTCTCTTGCAGGA
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTCTATATCGGCCGACTCGTGTCCGGCGTCAC
GGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACA
TGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATCTCTGCTCATGCCCCG
TTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGCATTTTCCTCAAGGAGACTCATCACAGCCATGG
CGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCTGGATGATGCATTGCGCGGGCTAGGTGCGCTTT
TCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
GCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGCTGCGGATGCGACTGGCTTCGTTCTTCTGGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCGCCGGGGGTGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGAACGCTAACGAGCCTCACCAATCTAAGCTCTAT
CGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTTCATTGTGA

>MEG_7090|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETG
ATGGGTCTCGGCCTCATCATGCCCGTCCTTCCGACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTA
TGGTGCCTTGCTGTCGCTCTATGCATTGATGCAGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTC
GGCGTCCGGTACTTCTGGCTTCTCTTGCAGGAGCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTG
CTCTATATCGGCCGACTCGTGTCCGGCGTCACGGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGG
GGAAGGTTCTCGCGCACGCTGGTTCGGCTACATGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTG
GCATGCTCGGTGGTATCTCTGCTCATGCCCCGTTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGC
ATTTTCCTCAAGGAGACTCATCACAGCCATGGCGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCT
GGATGATGCATTGCGCGGGCTAGGTGCGCTTTTCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCC
TATGGGTCATATATGGCGAGGACCGTTTTCAGTGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACA
CATGCGATCTTCCAAGCGTTTGTTACCGGCCCGCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGC
TGCGGATGCGACTGGCTTCGTTCTTCTGGCTTTTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCG
CCGGGGGTGTTGGCATGCCGGCCTTGCAGGCAATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGA
ACGCTAACGAGCCTCACCAATCTAAGCTCTATCGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGC
ATGGAACGGTTGGGTTTGGATTGTCGGCGCGATCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTT
CATTGTGA

>MEG_7091|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETG
GCTGCTGATCGTGGGTCTCGACGCCATGGGACTCGGCCTCATCATGCCGGTCCTTCCGGCGCTTCTGCGCGAGCTTGTGC
CGGCGGAGCAGGTCGCTGGTCACTATGGTGCTTTGCTGTCACTCTATGCGTTGATGCAGGTCATCTTCGCGCCCGTGCTT
GGACAGTTTTCAGATGCTTACGGTCGGCGTCCGGTGCTTCTGGCTTCTCTTGCGGGGGCCGCAGTCGATTACACGATTAT
GGCATCAGCGCCGGTCTTATGGGTTCTCTATATCGGCCGAATCGTTTCCGGCGTCACGGGAGCAACCGGAGCCGTAGCAG
CCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACATGGGGGCCTGTTATGGAGCAGGC
ATGATTGCCGGGCCAGCACTTTGTGGCATGCTCGGTGGTATTTCTGCCCATGCTCCGTTTATCGCTGCTGCCCTTCTCAA
CGGCTTCGCGTTCCTGCTTGCCTACATTTTTCTCAAGGAGACTCATCACAGCCATGGCGGGACCCGAAAGCCGGTTCGCA
TCAAACCATTCGTTCTGTTCCGGCTGGATGATACATTGCGCGGGCTAGGTGCGCTTTTCGCAGTTTTCTTCATTATTCAA
CTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATCTATGGCGAGGACCGTTTTCAGTGGGACACCACGACTGTTGGTTT
GTCGCTCGCGGCATTTGGAGCAACACACGCGATCTTCCAAGCGTTTGTTACCGGTCCGCTTTCAAGCCGGCTTGGAGAGC
GGCGCACGCTACTCTTTGGCATGGCTGCGGATGCGACTGGCTTCATTCTTCTGGCTTTTGCCACGCAGGGATGGATGGTG
TTCCCGATTTTGTTGCTGCTTGCCGCCGGAGGTGTTGGCATGCCGGCCTTGCAGGCAATGCTTTCAAATAATGTCAGCGG
TAACAAGCAAGGAGCTTTACAGGGAACGCTTACAAGCCTCACCAATTTAAGTTCTATCGCAGGACCGCTTGGCTTCACGG
CACTCTATTCTGCCACCGCCGGAGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGATCCTCTATTTAATATGTCTGCCA
ATACTACGCAGACCATTCGCA

>MEG_7092|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTGGGTCTTGACGCCATGGGTCTCGGCCTCATCATGCCCGTCCTTCC
GACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTATGGTGCCTTGCTGTCGCTCTATGCATTGATGC
AGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTCGGCGTCCGGTACTTCTGGCTTCTCTTGCAGGA
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTCTATATCGGCCGACTCGTGTCCGGCGTCAC
GGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACA
TGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATCTCTGCTCATGCCCCG
TTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGCATTTTCCTCAAGGAGACTCATCACAGCCATGG
CGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCTGGATGATGCATTGCGCGGGCTAGGTGCGCTTT
TCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
GCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGCTGCGGATGGCACTGGCTTCGTTCTTCTGGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCGCCGGGGGTGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGAACGCTAACGAGCCTCACCAATCTAAGCTCTAT
CGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTTCATTGGTGATTTAG

>MEG_7093|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTCGGTCTCGACGCCATAGGACTCGGCCTCATAATGCCGGTCCTTCC
GACGCTTCTGCGCGAGCTTGTGCCGGCAGAGCAGGTCGCTGGTCACTATGGTGCTTTGCTGTCGCTCTATGCGTTGATGC
AGGTCGTCTGCGCCCCTCTACTTGGGCAATTTTCAGATGGTTACGGTCGGCGTCCGGTGCTTCTGGCTTCTCTTGCGGGG
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTGTATATTGGCCGGCTCATTTCTGGCATCAC
GGGAGCAACCGGAGCTGTAGCTGCCTCAACCATTGCCGATTCGACAGGGGAAGGGTCTCGCGCACGCTGGTTCGGCTACA
TGGGAGCCTGTTATGGGACAGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATTTCTGCTCATGCTCCG
TTTATCGCCGCTGCCCTTCTAAACGGCTTCGCGTTCCTGCTTGCCTGCATTTTTCTCAAGGAGACTAATCGCAGCCATGG
CGAGACCGGAAAACTGGTCCGCATCGAACCATTCGTTCTGTTCCGGCTGGATGATGCATTGCGTGGACTAACCGCGCTTT
TCGCAGTTTTCTTCACTATTCAACTGATCGGCCAAGTGCCTGCGGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGGACACCACGACCGTTGGTTTGTCGCTCGCGGCGTTTGGAGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
TCTTTCAAGCCGGCTTGGAGAGCGGCGCACATTACTGTTTGGCATGGCTGCGGATGCGACTGGCTTCATTCTTCTAGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGCTGCTGCTTGCCGCCGGGGGCGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGAGCTCTACAGGGAACGCTTACAAGCCTCACCAATCTAAGCTCTAT
CGCGGGACCGCTTGGCTTCACGGCACTCTATTCTGCCACCATAGGAGCATGGACCGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCTTTCGCAACTTCATTGTGA