MEGAResFrom MEG, the Microbial Ecology Group

TET31

The tet31 gene encodes a tetracycline efflux pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/8534971

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_6978|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TET31
atgaatcgctatatcacaatcgccctcttaattaccttcctagatgcaacaggaatgggcttaatcatgcctgtattacc
aacacttttagaagagttctctgtcaaagagtctatcgccactcattatggttttatcctcgcaatctatgcgctgatgc
aagttatttttgcaccaatattaggacaactctcggataaatttggcagaaaaccggtcttgattctctcattaataggc
gctgtttgtgattacaccctactctcattttctagcgccttatggatgctctatctagggagaatgattgccggcatttc
tgctgcaacaggagccgtagcagcatcaatggtcgcagatcacacaaaaaaagcagagagaactaaatggtttggaaagt
taggcgcagcttttggggcgggactcattgccggacccgctattggtggatttatcggacaatattctgcacatttcccc
tttatcattgccgcaattttaaatgccattgctcttatcatggtcattatcctcttccctaaagagcaatcacgcccaaa
agaaatcgagcaagatcaatctaaaattcatgaaaaaaccaccatcaatgccccgctaattcatattctcaaacccgttt
tgctacttctcatgctgttttttacagtacaactcatcggacaaatccctgcatcaacttgggttctatttactgagtac
cgttttgagtggaatacctttaacattggtttatcccttgcagggctagggttaatgcatattatctttcaggcttttgt
cgcaggatatatcgcatctcgctggaaaaatgaaaccgtatttattctcggatttatactagatgcgagcgcattcttat
tactggcctttatctctcaagtttggctggtaattcctacattgatcttattagcaggaggaggcatcgccttaccggca
ttacaaggattaatctctataaagacagcagatgaacatcaaggaaagatacaaggtatcatggttagcctcactaatat
taccggaataattggaccgcccatttttgcattttcctttgcaaaaacggttacaaactgggatggcacactttggctaa
tcggtgctgtactctatagcattttattaggtctctattttctctatcaaaagatacgcgcctataaacaacttaagtct
caaactgcttaa

>MEG_6979|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TET31
ATGATAGGGAAACTTATAATGATGAATCGCTATATCACAATCGCCCTCTTAATTACCTTCCTAGATGCAACAGGAATGGG
CTTAATCATGCCTGTATTACCAACACTTTTAGAAGAGTTCTCTGTCAAAGAGTCTATCGCCACTCATTATGGTTTTATCC
TCGCAATCTATGCGCTGATGCAAGTTATTTTTGCACCAATATTAGGACAACTCTCGGATAAATTTGGCAGAAAACCGGTC
TTGATTCTCTCATTAATAGGCGCTGTTTGTGATTACACCCTACTCTCATTTTCTAGCGCCTTATGGATGCTCTATCTAGG
GAGAATGATTGCCGGCATTTCTGCTGCAACAGGAGCCGTAGCAGCATCAATGGTCGCAGATCACACAAAAAAAGCAGAGA
GAACTAAATGGTTTGGAAAGTTAGGCGCAGCTTTTGGGGCGGGACTCATTGCCGGACCCGCTATTGGTGGATTTATCGGA
CAATATTCTGCACATTTCCCCTTTATCATTGCCGCAATTTTAAATGCCATTGCTCTTATCATGGTCATTATCCTCTTCCC
TAAAGAGCAATCACGCCCAAAAGAAATCGAGCAAGATCAATCTAAAATTCATGAAAAAACCACCATCAATGCCCCGCTAA
TTCATATTCTCAAACCCGTTTTGCTACTTCTCATGCTGTTTTTTACAGTACAACTCATCGGACAAATCCCTGCATCAACT
TGGGTTCTATTTACTGAGTACCGTTTTGAGTGGAATACCTTTAACATTGGTTTATCCCTTGCAGGGCTAGGGTTAATGCA
TATTATCTTTCAGGCTTTTGTCGCAGGATATATCGCATCTCGCTGGAAAAATGAAACCGTATTTATTCTCGGATTTATAC
TAGATGCGAGCGCATTCTTATTACTGGCCTTTATCTCTCAAGTTTGGCTCGTAATTCCTACATTGATCTTATTAGCAGGA
GGAGGCATCGCCTTACCGGCATTACAAGGATTAATCTCTATAAAGACAGCAGATGAACATCAAGGAAAGATACAAGGTAT
CATGGTTAGCCTCACTAATATTACCGGAATAATTGGACCGCCCATTTTTGCATTTTCCTTTGCAAAAACGGTTACAAACT
GGGATGGCACACTTTGGCTAATCGGTGCTGTACTCTATAGCATTTTATTAGGTCTCTATTTTCTCTATCAAAAGATACGC
GCCTATAAACAACTTAAGTCTCAAACTGCTTAA

>MEG_6980|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|TET31
ATGATAGGGAAGCTTATAATGATGAATCGCTATATCACAATCGCCCTCTTAATTACCTTCCTAGATGCAACAGGAATGGG
CTTAATCATGCCTGTATTACCAACACTTTTAGAAGAGTTCTCTGTCAAAGAGTCTATCGCCACTCATTATGGTTTTATCC
TCGCAATCTATGCGCTGATGCAAGTTATTTTTGCACCAATATTAGGACAACTCTCGGATAAATTTGGCAGAAAACCGGTC
TTGATTCTCTCATTAATAGGCGCTGTTTGTGATTACACCCTACTCTCATTTTCTAGCGCCTTATGGATGCTCTATCTAGG
GAGAATGATTGCCGGCATTTCTGCTGCAACAGGAGCCGTAGCAGCATCAATGGTCGCAGATCACACAAAAAAAGCAGAGA
GAACTAAATGGTTTGGAAAGTTAGGCGCAGCTTTTGGGGCGGGACTCATTGCCGGACCCGCTATTGGTGGATTTATCGGA
CAATATTCTGCACATTTCCCCTTTATCATTGCCGCAATTTTAAATGCCATTGCTCTTATCATGGTCATTATCCTCTTCCC
TAAAGAGCAATCACGCCCAAAAGAAATCGAGCAAGATCAATCTAAAATTCATGAAAAAACCACCATCAATGCCCCGCTAA
TTCATATTCTCAAACCCGTTTTGCTACTTCTCATGCTGTTTTTTACAGTACAACTCATCGGACAAATCCCTGCATCAACT
TGGGTTCTATTTACTGAGTACCGTTTTGAGTGGAATACCTTTAACATTGGTTTATCCCTTGCAGGGCTAGGGTTAATGCA
TATTATCTTTCAGGCTTTTGTCGCAGGATATATCGCATCTCGCTGGAAAAATGAAACCGTATTTATTCTCGGATTTATAC
TAGATGCGAGCGCATTCTTATTACTGGCCTTTATCTCTCAAGTTTGGCTGGTAATTCCTACATTGATCTTATTAGCAGGA
GGAGGCATCGCCTTACCGGCATTACAAGGATTAATCTCTATAAAGACAGCAGATGAACATCAAGGAAAGATACAAGGTAT
CATGGTTAGCCTCACTAATATTACCGGAATAATTGGACCGCCCATTTTTGCATTTTCCTTTGCAAAAACGGTTACAAACT
GGGATGGCACACTTTGGCTAATCGGTGCTGTACTCTATAGCATTTTATTAGGTCTCTATTTTCTCTATCAAAAGATACGC
GCCTATAAACAACTTAAGTCTCAAACTGCTTAA