MEGAResFrom MEG, the Microbial Ecology Group

QEPA

The qepA gene encodes an efflux pump that can act on fluoroquinolones, therefore causing resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2043241/

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_5870|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTATTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGA
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>MEG_5871|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGG
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGAGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCTGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGCTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCAAGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGACGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>MEG_5872|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttattcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctga
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccgatgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctggactggtggcgcgcctgctgcgcaagcgcccagc
gctcgcatctggttga

>MEG_5873|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctga
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccagc
gctcgcatctggttga

>MEG_5874|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctga
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggctggggcagggcctgtggtggctggtgccggccacgatcgtca
tgggcctgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcg
gcctcggccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggt
ctaccggcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggg
gcgccgtgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgat
gcgctgcaggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcg
cccagcgctcgcatctggttga

>MEG_5875|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctgg
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccaac
gctcgcatctggttga

>MEG_5876|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgctcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctgg
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccgtgcacctggccgaca
ccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctgcaggccacggcctgg
gccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccagcgctcgcatctggttg
a

>MEG_5877|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
atgtccgccacgctccacgacaccgcagcggatcgtcggaaggccacccgccgcgaatggatcggcctggccgtggtcgc
cctgccgtgcctggtctacgccatggacctcacggtgctgaacctggcgctgccggtgctcagccgtgaactgcagccct
ccagcgcccagcttctctggatcctggacatctacggcttcttcgtcgccggcttcctgatcaccatgggcacgctgggc
gaccgcatcggccggcgccggctgttgttgatcggcgcggcgttcttcgcattcgcctcggtgttcgcggcgctggccga
taccgccgcgctgttgatcgcggcgcgcgccttgctcggcctggccggcgccaccatcgcgccgtccaccatggcgctgg
tccgcaacatgttccacgacccgcgccagcgccagttcgccatcggcgtgtggatcgccgcgttttcgctgggcagcgcg
atcggtccgctggtcggcggcgtgttgctggagttcttccactggggcgccgtgttctggctcaacgtgccggtgatgct
gctgacgctggcgctcggccctcgcttcctgcccgagtatcgtgatccggacgcggggcacctggacctggccagcgtgc
tgctgtcgctggcggcggtgctgctgacgatctacgggctcaagcagttggccgagcatggagcgggcctcgcctcgatg
gctgcgctgctggccgggctggcggtcggggcgctgttcctgcgccgccagggccacatcgcctacccgctgctggacct
gcggctgttcgcgcacgcgccgttccgcgcggcgctggcggcgtatgcgctggccgcgctggccatgttcggcgtctaca
tcttcatgacgcagtacctgcagctcgtgctggggctgtcgccgctgcaggccgggctggccacgctgccctggtccctg
tgcttcgtcatcggttcgctgttgtcgccgcagctcgcggcgcgctggccggcggcgcgcatcctcgtcgtgggcctgtc
ggcagcggcgttcggcttcgccgtgctggggctggggcagggcctgtggtggctggtgccggccacgatcgtcatgggcc
tgggcctggcgccggtgttcaccatcggcaacgagatcatcatcaccagcgcgccgtccgagcgcgcgggcgcggcctcg
gccttgtcggagacggtgtccgaattcagcggcgcgctgggcatcgcgctgttcggcagcgtcggcctggtggtctaccg
gcaggcgctgaccagcgcggcgctgcccggcctgccggccgatgcgctgcaggcggccggtgcctcgctcgggggcgccg
tgcacctggccgacaccctgccggcgtggcagggcgcggccttgctggcggccgcacgcgcgggcttcaccgatgcgctg
caggccacggcctgggccggcgcggtgctggtgctggtggccgctgggctggtggcgcgcctgctgcgcaagcgcccagc
gctcgcatctggttga

>MEG_5878|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGCCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGG
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA

>MEG_5879|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|QEPA
ATGTCCGCCACGCTCCACGACACCGCAGCGGATCGTCGGAAGGCCACCCGCCGCGAATGGATCGGCCTGGCCGTGGTCGC
CCTGCCGTGCCTGGTCTACGCCATGGACCTCACGGTGCTGAACCTGGCGCTGCCGGTGCTCAGCCGTGAACTGCAGCCCT
CCAGCGCCCAGCTTCTCTGGATCCTGGACATCTACGGCTTCTTCGTCGCCGGCTTCCTGATCACCATGGGCACGCTGGGC
GACCGCATCGGCCGGCGCCGGCTGTTGTTGATCGGCGCGGCGTTCTTCGCATTCGGCTCGGTGCTCGCGGCGCTGGCCGA
TACCGCCGCGCTGTTGATCGCGGCGCGCGCCTTGCTCGGCCTGGCCGGCGCCACCATCGCGCCGTCCACCATGGCGCTGA
TCCGCAACATGTTCCACGACCCGCGCCAGCGCCAGTTCGCCATCGGCGTGTGGATCGCCGCGTTTTCGCTGGGCAGCGCG
ATCGGTCCGCTGGTCGGCGGCGTGTTGCTGGAGTTCTTCCACTGGGGCGCCGTGTTCTGGCTCAACGTGCCGGTGATGCT
GCTGACGCTGGCGCTCGGCCCTCGCTTCCTGCCCGAGTATCGTGATCCGGACGCGGGGCACCTGGACCTGGCCAGCGTGC
TGCTGTCGCTGGCGGCGGTGCTGCTGACGATCTACGGGCTCAAGCAGTTGGCCGAGCATGGAGCGGGCCTCGCCTCGATG
GCTGCGCTGCTGGCCGGGCTGGCGGTCGGGGCGCTGTTCCTGCGCCGCCAGGGCCACATCGCCTACCCGCTGCTGGACCT
GCGGCTGTTCGCGCACGCGCCGTTCCGCGCGGCGCTGGCGGCGTATGCGCTGGCCGCGCTGGCCATGTTCGGCGTCTACA
TCTTCATGACGCAGTACCTGCAGCTCGTGCTGGGGCTGTCGCCGCTGCAGGCCGGGCTGGCCACGCTGCCCTGGTCCCTG
TGCTTCGTCATCGGTTCGCTGTTGTCGCCGCAGCTCGCGGCGCGCTGGCCGGCGGCGCGCATCCTCGTCGTGGGCCTGTC
GGCAGCGGCGTTCGGCTTCGCCGTGCTGGGGCTGGGGCAGGGCCTGTGGTGGCTGGTGCCGGCCACGATCGTCATGGGCC
TGGGCCTGGCGCCGGTGTTCACCATCGGCAACGAGATCATCATCACCAGCGCGCCGTCCGAGCGCGCGGGCGCGGCCTCG
GCCTTGTCGGAGACGGTGTCCGAATTCAGCGGCGCGCTGGGCATCGCGCTGTTCGGCAGCGTCGGCCTGGTGGTCTACCG
GCAGGCGCTGACCAGCGCGGCGCTGCCCGGCCTGCCGGCCGATGCGCTGCAGGCGGCCGGTGCCTCGCTCGGGGGCGCCG
TGCACCTGGCCGACACCCTGCCGGCGTGGCAGGGCGCGGCCTTGCTGGCGGCCGCACGCGCGGGCTTCACCGATGCGCTG
CAGGCCACGGCCTGGGCCGGCGCGGTGCTGGTGCTGGTGGCCGCTGGGCTGGTGGCGCGCCTGCTGCGCAAGCGCCCAGC
GCTCGCATCTGGTTGA