MEGAResFrom MEG, the Microbial Ecology Group

NORA

The norA gene encodes a multi-drug efflux pump that, when overexpressed, can act effectively on fluoroquinolones, therefore causing resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC89076/

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_4208|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|NORA
ATGAATAAACAGATTTTGGTATTATATTTTAATATTTTCTTAATTTTTTTAGGTATCGGTCTAGTGATACCAGTCTTACC
TGTTTATTTAAAAGATTTGGGGTTAACTGGTAGTGATTTAGGATTATTAGTTGCTGCTTTCGCCTTATCTCAAATGATTA
TATCGCCATTCGGTGGTACGTTAGCTGATAAATTAGGAAAGAAATTAATTATATGTATAGGATTAATTTTGTTTTCAGTG
TCAGAATTTATGTTTGCTATCGGTCAGAATTTTTTAATTTTGATGTTATCAAGGGTTATCGGTGGTATGAGTGCTGGTAT
GGTTATGCCTGGGGTGACAGGTTTAATAGCTGATATTTCACCAAGCCATCAAAAAGCAAAAAACTTTGGCTACATGTCAG
CGATTATCAATTCAGGATTCATTTTAGGACCAGGGATTGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTAT
TTTGCAGGTGCATTAGGTATTCTAGCATTTATAATGTCAATTGTATTGATTCACGACCCTAAAAAAGTTTCGACAAATGG
ATTCCAAAAGTTGGAGCCACAATTGCTAACGAAAATTAACTGGAAAGTGTTTATTACACCAGTTATTCTAACACTTGTAT
TATCGTTTGGTTTATCTGCATTTGAAACATTGTATTCACTATACACAGCTGACAAGGTAAATTATTCACCTAAAGATATT
TCGATTGCAATTACAGGTGGCGGTATCTTTGGTGCACTTTTCCAAATTTATTTCTTTGATAAATTTATGAAATACTTCTC
TGAGTTAACATTTATTGCATGGTCATTAATATATTCAGTTATTGTATTAGTGCTATTAGTTATTGCCGATGGTTACTGGA
CAATTATGGTAATAAGCTTTGTTGTCTTTATCGGGTTCGATATGATAAGACCTGCTATTACAAATTATTTTTCAAATATT
GCTGGTGATAGACAGGGATTTGCAGGTGGGTTAAACTCAACATTCACTAGCATGGGGAATTTTATAGGTCCTTTAATCGC
AGGTGCGTTATTTGATGTGCACATTGAAGCCCCAATTTATATGGCTATAGGTGTGTCATTAGCTGGTGTTGTCATTGTTT
TAATTGAAAAGCAACATAGAGCTAAGTTAAAACAACAAGATTTGTAA

>MEG_4209|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|NORA
ATGAATAAACAGATTTTTGTCTTATATTTTAATATTTTCTTGATTTTTTTAGGTATCGGTTTAGTAATACCAGTCTTGCC
TGTTTATTTAAAAGATTTGGGATTAACTGGTAGTGATTTAGGATTACTAGTTGCTGCTTTTGCGTTATCTCAAATGATTA
TATCGCCGTTTGGTGGTACGCTAGCTGACAAATTAGGGAAGAAATTAATTATATGTATAGGATTAATTTTGTTTTCAGTG
TCAGAATTTATGTTTGCAGTTGGCCACAATTTTTCGGTATTGATGTTATCGAGAGTGATTGGTGGTATGAGTGCTGGTAT
GGTAATGCCTGGTGTGACAGGTTTAATAGCTGACATTTCACCAAGCCATCAAAAAGCAAAAAACTTTGGCTACATGTCAG
CGATTATCAATTCTGGATTCATTTTAGGACCAGGGATTGGTGGATTTATGGCAGAAGTTTCACATCGTATGCCATTTTAC
TTTGCAGGAGCATTAGGTATTCTAGCATTTATAATGTCAATTGTATTGATTCACGATCCGAAAAAGTCTACGACAAGTGG
TTTCCAAAAGTTAGAGCCACAATTGCTAACGAAAATTAACTGGAAAGTGTTTATTACACCAGTTATTTTAACACTTGTAT
TATCGTTTGGTTTATCTGCATTTGAAACATTGTATTCACTATACACAGCTGACAAGGTAAATTATTCACCTAAAGATATT
TCGATTGCTATTACGGGTGGCGGTATATTTGGGGCACTTTTCCAAATCTATTTCTTCGATAAATTTATGAAGTATTTCTC
AGAGTTAACATTTATAGCTTGGTCATTATTATATTCAGTTGTTGTCTTAATATTATTAGTTTTTGCTAATGGCTATTGGT
CAATAATGTTAATCAGTTTTGTTGTCTTCATAGGTTTTGATATGATACGACCAGCCATTACAAATTATTTTTCTAATATT
GCTGGAGAAAGGCAAGGCTTTGCAGGCGGATTGAACTCGACATTCACTAGTATGGGTAATTTCATAGGTCCTTTAATCGC
AGGTGCGTTATTTGATGTACACATTGAAGCACCAATTTATATGGCTATAGGTGTTTCATTAGCAGGTGTTGTTATTGTTT
TAATTGAAAAGCAACATAGAGCAAAATTGAAAGAACAAAATATGTAG

>MEG_4210|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|NORA
CAGCTGACAAGGTAAATTATTCACCTAAAGATATTTCGATTGCTATTACGGGTGGCGGTATATTTGGGGCACTTTTCCAA
ATCTATTTCTTCGATAAATTTGTGAAGTATTTCTCAGAGTTAACATTTATAGCTTGGTCATTATTATATTCAGTTGTTGT
CTTAATATTATTAGTTTTTGCTAATGGCTATTGGTCAATAATGTTAATCAGTTTTGTTGTCTTCATAGGTTTTGATATGA
TACGACCAGCCATTACAAATTATTTTTCTAATATTGCTGGAGAAAGGCAAGGCTTTGCAGGCGGATTGAACTCGACATTC
ACTAGTATGGGTAATTTCATAGGTCCTTTAATCGCAGGTGCGTTATTTGATGTACACATTGAAGCACCAATTTATATGGA
TATAGGTGTTTCATTAGCAGGTGTTGTTATTGTTTTAATTGAAAAGCAACATAGAGCAAAATTGAAAGAACAAAATATGT
AG

>MEG_4211|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|NORA
ATGAAAAAACAATTATTCATTCTTTATTTTAATATATTTCTTATATTTTTAGGGATTGGATTAGTTATTCCTGTACTTCC
TGTATATTTGAAGGATTTAGGATTAAAAGGTAGTGACTTAGGAATGCTAGTTGCTGCTTTTGCATTATCACAAATGATTA
TTTCACCATTTGGTGGGACACTAGCTGATAAATTGGGTAAAAAATTAATTATATGTATCGGTTTAGTATTCTTTGCTGTC
TCTGAATTTATGTTCGCAGCCGGTCAAAGTTTTACCATTTTAATCATTTCACGTGTTTTAGGTGGCTTTAGTGCAGGCAT
GGTCATGCCTGGTGTAACAGGTATGATTGCAGATATTTCTCCAGGAGCTGATAAAGCTAAAAACTTTGGTTACATGTCGG
CAATTATTAATTCAGGTTTTATATTAGGACCTGGATTTGGAGGCTTTTTAGCTGAAATTTCACATAGATTACCTTTCTAT
GTTGCTGGAACATTAGGTGTTGTTGCATTCATTATGTCAGTTTTATTAATTCATAATCCTCAAAAAGCAACTACAGATGG
ATTCCACCAATATCAACCTGAATTATTCACTAAAATTAATTGGAAAGTATTTATTACTCCAGTCATATTAACACTTGTAT
TAGCATTTGGTTTATCTGCTTTTGAAACATTATTTTCTTTATATACAGCTGACAAAGTAAATTATACTCCTAAAGATATT
TCGATAGCTATTATCGGTGGAGGCGTGTTTGGCGCATTATTCCAAGTATTCTTCTTTGATAAATTTATGAAATATATGAG
TGAACTTAATTTTATTGCATGGTCATTACTATATTCAGCCATTGTTCTCGTTATGTTAGTGCTTGCAAACGGTTATTGGA
CGATTATGATTATTAGCTTTGTTGTTTTTATAGGTTTTGATATGATTAGACCAGCTTTAACCAATTACTTCTCGAATATA
GCAGGCAAACGGCAAGGTTTTGCAGGTGGATTGAATTCAACTTTTACCAGTATGGGTAACTTTATAGGTCCTCTTGTAGC
TGGTGCATTATTCGATGTTAATTTAGAGTTTCCTTTATATATGGCTATTGCGGTTTCATTAAGTGGAATTATCATTATTT
TTATTGAAAAAGGACTTAAGTCACGCCGTAAAGAAGCAAATTAA