MEGAResFrom MEG, the Microbial Ecology Group

EMRD

The emrD gene encodes a multi-drug efflux pump in Escherichia coli.

References

  • http://aac.asm.org/content/45/4/1126.full

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_2728|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|EMRD
GTGATAATGAAAAGGCAAAGAAACGTCAATTTGTTATTGATGTTGGTATTACTCGTGGCCGTCGGTCAGATGGCGCAAAC
CATTTATATTCCAGCTATTGCCGATATGGCGCGCGATCTCAACGTCCGTGAAGGGGCGGTGCAGAGCGTAATGGGCGCTT
ATCTGCTGACTTACGGTGTCTCACAGCTGTTTTATGGCCCGATTTCCGACCGCGTGGGCCGCCGACCGGTGATCCTCGTC
GGAATGTCCATTTTTATGCTGGCAACGCTGGTCGCGGTCACGACCTCCAGTTTGACGGTGTTGATTGCCGCCAGCGCGAT
GCAGGGGATGGGCACCGGCGTTGGCGGCGTAATGGCGCGTACTTTACCGCGAGATTTATATGAACGGACACAGTTGCGCC
ATGCTAACAGCCTGTTAAACATGGGGATTCTCGTCAGTCCGTTGCTCGCACCGCTAATCGGCGGTCTGCTGGATACGATG
TGGAACTGGCGCGCCTGTTATCTCTTTTTGTTGGTTCTTTGTGCTGGTGTGACCTTCAGTATGGCCCGCTGGATGCCGGA
AACGCGTCCGGTCGATGCACCGCGCACGCGCCTGCTTACCAGTTATAAAACGCTTTTCGGTAACAGCGGTTTTAACTGTT
ATTTGCTGATGCTGATTGGCGGTCTGGCCGGGATTGCCGCCTTTGAAGCCTGCTCCGGCGTGCTGATGGGCGCGGTGTTA
GGGCTGAGCAGTATGACGGTCAGTATTTTGTTTATTCTGCCGATTCCGGCAGCGTTTTTTGGCGCATGGTTTGCCGGACG
TCCCAATAAACGCTTCTCCACGTTAATGTGGCAGTCGGTTATCTGCTGCCTGCTGGCTGGCTTGCTGATGTGGATCCCCG
ACTGGTTTGGCGTGATGAATGTCTGGACGCTGCTCGTTCCCGCCGCGCTGTTCTTTTTCGGTGCCGGGATGCTGTTTCCG
CTGGCGACCAGCGGCGCGATGGAGCCGTTCCCCTTCCTGGCGGGCACGGCTGGCGCGCTGGTCGGCGGTCTGCAAAACAT
TGGTTCCGGCGTGCTGGCGTCGCTCTCTGCGATGTTGCCGCAAACCGGTCAGGGCAGCCTGGGGTTGTTGATGACCTTAA
TGGGATTGTTGATCGTGCTGTGCTGGCTGCCGCTGGCGACGCGGATGTCGCATCAGGGGCAGCCCGTTTAA

>MEG_2729|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|EMRD
ATGAAAAGGCAAAGAAACGTCAATTTGTTATTGATGTTGGTATTACTCGTGGCCGTCGGTCAGATGGCGCAAACCATTTA
TATTCCAGCTATTGCCGATATGGCGCGCGATCTCAACGTCCGTGAAGGGGCGGTGCAGAGCGTAATGGGCGCTTATCTGC
TGACTTACGGTGTCTCACAGCTGTTTTATGGCCCGATTTCCGACCGCGTGGGCCGCCGACCGGTGATCCTCGTCGGAATG
TCCATTTTTATGCTGGCAACGCTGGTCGCGGTCACGACCTCCAGTTTGACGGTGTTGATTGCCGCCAGCGCGATGCAGGG
GATGGGCACCGGCGTTGGCGGCGTAATGGCGCGTACTTTACCGCGAGATTTATATGAACGGACACAGTTGCGCCATGCTA
ACAGCCTGTTAAACATGGGGATTCTCGTCAGTCCGTTGCTCGCACCGCTAATCGGCGGTCTGCTGGATACGATGTGGAAC
TGGCGCGCCTGTTATCTCTTTTTGTTGGTTCTTTGTGCTGGTGTGACCTTCAGTATGGCCCGCTGGATGCCGGAAACGCG
TCCGGTCGATGCACCGCGCACGCGCCTGCTTACCAGTTATAAAACGCTTTTCGGTAACAGCGGTTTTAACTGTTATTTGC
TGATGCTGATTGGCGGTCTGGCCGGGATTGCCGCCTTTGAAGCCTGCTCCGGCGTGCTGATGGGCGCGGTGTTAGGGCTG
AGCAGTATGACGGTCAGTATTTTGTTTATTCTGCCGATTCCGGCAGCGTTTTTTGGCGCATGGTTTGCCGGACGTCCCAA
TAAACGCTTCTCCACGTTAATGTGGCAGTCGGTTATCTGCTGCCTGCTGGCTGGCTTGCTGATGTGGATCCCCGACTGGT
TTGGCGTGATGAATGTCTGGACGCTGCTCGTTCCCGCCGCGCTGTTCTTTTTCGGTGCCGGGATGCTGTTTCCGCTGGCG
ACCAGCGGCGCGATGGAGCCGTTCCCCTTCCTGGCGGGCACGGCTGGCGCGCTGGTCGGCGGTCTGCAAAACATTGGTTC
CGGCGTGCTGGCGTCGCTCTCTGCGATGTTGCCGCAAACCGGTCAGGGCAGCCTGGGGTTGTTGATGACCTTAATGGGAT
TGTTGATCGTGCTGTGCTGGCTGCCGCTGGCGACGCGGATGTCGCATCAGGGGCAGCCCGTTTAA

>MEG_2730|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|EMRD
ATGAAGACGAAGCCTTCTCTCTGGTTGATGGTGATTATGTTGATGTTTCCACAAATCGTCGAAACCATCTATAGCCCGGT
GTTGGGCTCTATTGCGCGGTCATTTTCGGTGAGTGATGCCCAAGCCGCTCAAACCTTGTCGGTCTATTTTTTGGCTTTTG
CATTGGGAGTGGTGATATGGGGAGTACTCGCGGATAAATGGGGGCGTCGGCCTACTATGTTGGTGGGCCTACTGATTTAC
GGGAGCGCTACATTTATCGCAATGCAGACAGACAGTTTCACTATCTTGATGTTAGCACGAGTATTCAGCGCCTTTGGTAT
CGCTGTCGGTTCCGTGGTAACGCAAACTATTTTACGCGATGTGTTCAGTGGTCATGAACTGAGAAAAGTTTTTAGTTTAA
TGGGGATAGGTATATCTATAAGCCCAGTGCTAGGGATGTTGCTTGGTGGGCAGTTAGCGTTTGCAGGTGGGCATCAATTA
GTTTTTCTGGCGCTATTTTTTATAGCTCTGGTGCTGTTCGTTTATAACTTGTGTCAGCTTCCCGAAACGCAACAGGTCAA
GCCGAAGATCGCATTGGGTTGTTTAGTGGCTCGAATGTTTAAAGATAGACAAGTGCTGCTTTCAGCACTGCTAGTGGCGT
TATACAACGTGGCCTTATTTTCTTATTACCAGCTTGGTGCCTTTATCTTTAGCGATTTGGGGTTAGATGCGGAACAGTTT
GGCTATAGTGGTATTGCACTTGGCCTCGGTAGCTTAATCGGGAGCTTTCTTAACAAAACGTTGCTTGCTAAACAGGTGCC
ACAGCGTGCGCTGCTTTTACTGGCAGCACTGTTATTAATCATGGGAACTATAGGCGTATCTTTGACGCTTGATTCGATCG
GTTTTGTGGCCGCAATGATATTGGTTGTGATCGCTTATGGTATGGCGATTCCGAATATCTTGAGCACTGCACTGGTGGAG
TATAAATCGCAAGCAGGGAGTGCTGGAGCGCTGTTTGGCCTGCTCTATTATCTTTTGATTGGTAGTGGTTTGGCGCTCAC
GGGTTTAGTACAACGTTTAGGTGTCGTGCTTCTGATGTGCGCTGGTATCACCTTGTTGGCAACCTTAGCTCGCTCTAGTC
ACATAGCCCGTCTACCATGA