MEGAResFrom MEG, the Microbial Ecology Group

CMRA

The cmrA gene encodes a chloramphenicol exporter.

References

  • http://onlinelibrary.wiley.com/doi/10.1016/j.femsre.2004.04.001/pdf

Other Groups in Drug and biocide MFS efflux pump

Sequences

Download Sequences

>MEG_1779|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|CMRA
GTGCCATTCGCCATCTATGTCCTGGGTATTGCTGTATTCGCCCAGGGCACATCGGAATTCATGCTGTCCGGACTCATACC
GGATATGGCTCAGGATCTACAGGTTTCGGTCCCCACTGCAGGACTTCTCACTTCGGCATTCGCAATCGGCATGATCATCG
GTGCCCCGTTGATGGCAATTGTCAGTATGCGGTGGCAACGTCGACGAGCGCTCTTGACCTTCCTCATCACTTTTATGGTT
GTGCATGTCATCGGCGCACTCACCGACAGTTTCGGCGTCTTGCTGGTCACCCGGATCGTAGGAGCACTGGCCAACGCCGG
TTTCCTGGCTGTAGCGCTGGGCGCAGCCATGTCGATGGTTCCTGCCGACATGAAGGGACGAGCGACCTCAGTTCTACTGG
GCGGAGTGACCATCGCCTGCGTAGTTGGAGTCCCGGGCGGAGCGCTATTGGGCGAACTGTGGGGATGGCGCGCCTCGTTC
TGGGAGGTAGTGCTGATTTCCGCACCGGCAGTGGCAGCGATCATGGCATCGACCCCTGCTGATTCCCCTACAGATTCTGT
TCCGAACGCGACCCGCGAACTGTCCTCGCTGCGTCAACGCAAACTTCAACTGATCTTGGTGCTGGGCGCGCTGATCAACG
GTGCCACCTTCTGTTCCTTCACCTACCTGGCTCCGACGCTCACCGACGTCGCCGGGTTCGACTCTCGCTGGATCCCTTTG
CTTCTCGGACTGTTCGGACTGGGGTCGTTCATCGGCGTCAGTGTCGGTGGCCGGCTCGCTGACACCCGTCCGTTTCAATT
GCTGGTGGCGGGCTCGGCAGCTCTTCTGGTCGGGTGGATCGTGTTCGCTATCACTGCCTCTCACCCGGTAGTGACCCTGG
TGATGCTGTTCGTGCAAGGAACGCTGTCGTTCGCTGTGGGGTCGACGTTGATCTCGCGAGTGCTCTACGTCGCCGACGGT
GCTCCGACTTTGGGGGGATCCTTCGCTACGGCTGCCTTCAATGTCGGAGCCGCATTGGGGCCGGCCCTCGGCGGTGTGGC
CATCGGTATCGGAATGGGCTATCGCGCTCCACTGTGGACCAGCGCGGCTCTGGTGGCACTTGCGATCGTGATCGGTGCCG
CGACGTGGACGCGTTGGCGGGAACCACGTCCAGCGCTGGACACCGTTCCTCCGTGA

>MEG_1780|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pump|CMRA
GTGCCTTTCGCTATCTACGTCCTCGGGCTTGCCGTCTTTGCCCAGGGCACATCCGAATTCATGTTGTCCGGGCTCATACC
GGATATGGCCCGCGACCTCGGCGTCTCGGTCCCCGCCGCCGGACTCCTCACCTCCGCCTTCGCGGTCGGGATGATCATCG
GCGCTCCGCTGATGGCCATCGCCAGCATGCGGTGGCCCCGGCGACGCGCCCTTTTGACATTCCTCATCACGTTCATGCTG
GTCCACGTCATCGGCGCGCTCACCAGCAGCTTCGAGGTCTTGCTGGTCACACGCATCGTCGGCGCCCTCGCCAACGCCGG
ATTCTTGGCGGTGGCCCTGGGCGCGGCGATGGCGATGGTGCCCGCCGACATGAAAGGGCGCGCAACGTCCGTCCTCCTCG
GTGGTGTCACGATCGCATGTGTAGCCGGAGTTCCCGGGGGCGCCTTCCTCGGTGAAATATGGGGCTGGCGTGCAGCGTTC
TGGGCTGTCGTCGTCATCTCCGCCCCTGCGGTGGTGGCGATCATGTTCGCCACCCCGGCCGAGCCGCCAGCAGAGTCCAC
ACCGAACGCCAAGCGTGAACTGTCCTCGCTGCGCTCACGCAAGCTCCAGCTGATGCTTGTCCTCGGTGCCCTGATCAACG
GCGCAACATTCTGTTCGTTCACCTACATGGCGCCCACTCTCACCGACATCTCCGGTTTCGACTCCCGTTGGATTCCGTTG
CTGCTGGGGTTGTTCGGGCTCGGATCGTTCATCGGCGTCAGCGTCGGAGGCAGGCTCGCCGATACCCGGCCGTTCCAACT
TCTCGCCGTGGGATCCGCAGCACTGTTGACGGGATGGATCGTCTTCGCTCTCACGGCATCCCACCCTGCGGTGACATTGG
TGATGCTGTTCGTGCAGGGCGCTCTGTCCTTCGCGGTCGGCTCGACCTTGATCTCCCAGGTGCTCTACGCCGCCGACGCG
GCGCCGACCTTGGGTGGATCGTTCGCGACGGCCGCGTTCAACGTCGGCGCTGCACTGGGCCCGGCCCTCGGCGGGCTGGC
GATCGGTATGGGCCTGAGCTACCGCGCCCCGCTCTGGACGAGCGCCGCGCTGGTGACTCTCGCGATCGTCATCGGCGCAG
CCACCTTGTCGCTCTGGCGGCGTCCAGCGTCCGTCCAGGAAACCGTCCCAGCCTGA