MEGAResFrom MEG, the Microbial Ecology Group

MEPR

The mepR gene encodes a transcriptional regulator that affects the expression of the MepA efflux pump.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Sequences

Download Sequences

>>MEG_3836|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_regulator|MEPR
ATGGAATTCACTTATTCGTATTTATTTAGAATGATTAGTCATGAGATGAAACAAAAGGCTGATCAAAAGTTAGAGCAATT
TGATATTACAAATGAGCAAGGTCATACGTTAGGTTATCTTTATGCACATCAACAAGATGGACTGACACAAAATGATATTG
CTAAAGCATTACAACGAACAGGTCCAACTGTCAGTAATTTATTAAGGAACCTTGAACGTAAAAAGCTGATCTATCGCTAT
GTCGATGCACAAGATACGAGAAGAAAGAATATAGGACTGACTACCTCTGGGATTAAACTTGTAGAAGCATTCACTTCGAT
ATTTGATGAAATGGAGCAAACACTCGTATCGCAGTTATCTGAAGAAGAAAATGAACAAATGAAAGCAAACTTAACTAAAA
TGTTATCTAGTTTACAATAA