MEGAResFrom MEG, the Microbial Ecology Group

MDTK

The mdtK gene encodes a multi-drug efflux pump in Salmonella enterica.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/16359323

Other Groups in Drug and biocide MATE efflux pumps

Sequences

Download Sequences

>>MEG_3758|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pumps|MDTK
GTGCAGAAGTATATCAGTGAAGCGCGTCTGTTATTAGCATTAGCAATCCCGGTGATTCTCGCGCAAATCGCCCAAACTGC
GATGGGTTTTGTCAGTACCGTGATGGCGGGCGGCTATAGTGCCACCGACATGGCGGCGGTCGCTATCGGTACTTCTATCT
GGCTTCCGGCGATCCTCTTTGGTCACGGACTGCTGCTGGCATTAACGCCGGTTATCGCGCAATTAAATGGTTCCGGTCGA
CGTGAGCGCATTGCGCATCAGGTGCGACAAGGTTTCTGGCTGGCAGGTTTTGTTTCCGTTCTCATTATGCTGGTGCTGTG
GAATGCAGGTTACATTATCCGCTCCATGGAAAACATCGATCCGGCTCTGGCGGACAAAGCCGTGGGTTATCTGCGTGCGT
TGTTGTGGGGCGCGCCGGGATATCTGTTCTTCCAGGTTGCCCGTAACCAGTGTGAAGGTCTGGCAAAAACCAAGCCGGGT
ATGGTAATGGGCTTTATCGGCCTGCTGGTGAACATCCCGGTGAACTATATCTTTATTTATGGTCATTTCGGTATGCCTGA
GCTCGGTGGCGTTGGTTGTGGCGTGGCTACTGCGGCGGTGTATTGGGTCATGTTCCTTGCCATGGTTTCTTACATTAAAC
GCGCCCGCTCCATGCGCGATATTCGTAACGAAAAAGGCACCGCAAAACCCGATCCTGCGGTTATGAAACGACTGATTCAA
CTCGGTTTGCCGATTGCGCTGGCACTGTTCTTTGAAGTGACACTGTTTGCCGTCGTGGCTCTGTTAGTGTCTCCGCTCGG
TATTGTTGATGTCGCAGGACACCAGATTGCCCTGAACTTTAGTTCACTAATGTTCGTGCTTCCAATGTCGCTGGCGGCAG
CGGTAACTATCCGCGTAGGTTATCGTCTGGGTCAGGGCTCAACGCTGGATGCGCAAACCGCTGCGCGGACCGGGCTTATG
GTGGGTGTCTGTATGGCAACCCTGACGGCCATTTTCACGGTTTCACTGCGGGAGCAAATCGCCCTGTTGTACAACGACAA
TCCCGAGGTTGTAACGCTGGCTGCGCATTTGATGTTGCTGGCGGCGGTATATCAGATTTCTGACTCAATCCAGGTGATTG
GCAGTGGGATTTTGCGTGGTTATAAAGATACGCGTTCCATTTTCTATATTACCTTTACGGCTTACTGGGTGCTGGGCTTG
CCAAGCGGCTATATTCTGGCACTGACCGATCTGGTCGTTGAACCTATGGGGCCAGCAGGCTTCTGGATAGGCTTTATTAT
TGGCCTGACGTCGGCAGCCATTATGATGATGTTGCGTATGCGGTTCCTGCAACGTCTGCCGTCAGCCATCATTCTGCAAC
GAGCATCCCGCTAA

>>MEG_3759|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pumps|MDTK
GTGCAGAAGTATATCAGTGAAGCGCGTCTGTTATTAGCATTAGCAATCCCGGTGATTCTCGCGCAAATCGCCCAAACTGC
GATGGGTTTTGTCGATACCGTGATGGCGGGCGGCTATAGTGCCACCGACATGGCGGCGGTCGCTATCGGTACTTCTATCT
GGCTTCCGGCGATCCTCTTTGGTCACGGACTGCTGCTGGCATTAACGCCGGTTATCGCGCAATTAAATGGTTCCGGTCGA
CGTGAGCGCATTGCGCATCAGGTGCGACAAGGTTTCTGGCTGGCAGGTTTTGTTTCCGTTCTCATTATGCTGGTGCTGTG
GAATGCAGGTTACATTATCCGCTCCATGGAAAACATCGATCCGGCTCTGGCGGACAAAGCCGTGGGTTATCTGCGTGCGT
TGTTGTGGGGCGCGCCGGGATATCTGTTCTTCCAGGTTGCCCGTAACCAGTGTGAAGGTCTGGCAAAAACCAAGCCGGGT
ATGGTAATGGGCTTTATCGGCCTGCTGGTGAACATCCCGGTGAACTATATCTTTATTTATGGTCATTTCGGTATGCCTGA
GCTCGGTGGCGTTGGTTGTGGCGTGGCTACTGCGGCGGTGTATTGGGTCATGTTCCTTGCCATGGTTTCTTACATTAAAC
GCGCCCGCTCCATGCGCGATATTCGTAACGAAAAAGGCACCGCAAAACCCGATCCTGCGGTTATGAAACGACTGATTCAA
CTCGGTTTGCCGATTGCGCTGGCACTGTTCTTTGAAGTGACACTGTTTGCCGTCGTGGCTCTGTTAGTGTCTCCGCTCGG
TATTGTTGATGTCGCAGGACACCAGATTGCCCTGAACTTTAGTTCACTAATGTTCGTGCTTCCAATGTCGCTGGCGGCAG
CGGTAACTATCCGCGTAGGTTATCGTCTGGGTCAGGGCTCAACGCTGGATGCGCAAACCGCTGCGCGGACCGGGCTTATG
GTGGGTGTCTGTATGGCAACCCTGACGGCCATTTTCACGGTTTCACTGCGGGAGCAAATCGCCCTGTTGTACAACGACAA
TCCCGAGGTTGTAACGCTGGCTGCGCATTTGATGTTGCTGGCGGCGGTATATCAGATTTCTGACTCAATCCAGGTGATTG
GCAGTGGGATTTTGCGTGGTTATAAAGATACGCGTTCCATTTTCTATATTACCTTTACGGCTTACTGGGTGCTGGGCTTG
CCAAGCGGCTATATTCTGGCACTGACCGATCTGGTCGTTGAACCTATGGGGCCAGCAGGCTTCTGGATAGGCTTTATTAT
TGGCCTGACGTCGGCAGCCATTATGATGATGTTGCGTATGCGGTTCCTGCAACGTCTGCCGTCAGCCATCATTCTGCAAC
GAGCATCCCGCTAA

>>MEG_3760|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pumps|MDTK
TTGAACGTCTCCACTGCCTTACGCCAGGCTGTCGTCCGTACGCCCTGGTATGCCAAACGCAAGAGCTACAAAGTGTTGTT
CTGGCGTGAAATCACCCCACTTGCTATCCCTATTTTTCTGGAAAATACCTGTGTTTTGCTAATGGGCGTGCTCAGTACTT
TTCTCGTCAGTTGGCTGGGCAAGGAAGCAATGGCGGGCGTGGGGCTTGCCGACAGTTTTAATATGGTAATTATGGCTTTT
TTTGCGGCTATCGATCTTGGTACTACGGTGGTGGTCGCCTTTAGCCTCGGCAAGCGCGACAGGCGACGCGCAAGGGCGGC
GGCGCGCCAGTCGCTGGTGATTATGACGCTATTTGCCGTTGTGCTGGCAGTGGTCATTCATTATTTCGGCAGTGAAATTA
TTAATATTGTCGCAGGCGAGGCGACGCCAGAAGTAAAGGGGCTGGCGTTAACGTACCTTGAACTGACGGTGCTGAGTTAT
CCGGCTGCGGCAATTGCGCTAATCGGTAGCGGCGCGCTGCGTGGGGCAGGGAATACGAAAATCCCGTTGATGATTAACGG
CGGGATGAACATTCTCAATATTATTATCAGCAGCATCCTGATTTACGGGGCTTTCTCCTGGCAAGGGCTGGGTTTTGCCG
GCGCGGGGCTGGGATTAACCATTTCGCGCTACATCGGCGCGGTAGCGATTATTTGGGTGCTGATGATTGGTTTTAATCCG
GCGCTGCGCATTCCGCTGAAAAGCTATCTGAAGCCGCTGAATTTCGGCATTATCTGGGAAGTGATGGGTATCGGTATTCC
GGCGAGCATTGAATCAGTGCTGTTCAACGGTAGCAAGCTACTGACGCAAATGTTTGTCGCCGGAATGGGCACTAACGTTA
TTGCGGGTAACTTTATTGCCTTTTCCGTGGCGGCGCTTATCAACCTGCCGGGTAACGCCCTTGGTTCGGCGTCGACTATT
ATCACCGGTAAGCGTCTTGGTACCGGGCAAATTGGTCAGGCAGAGCGTCAACTGCGCCATGTATTCTGGATGTCGACTAT
CGTACTTACGGCAATTGCCTGGGGGACGGCGCCGTTTGCGGGTCTGTTTGCCTCATTTTATACCCAGGAGCAGGACGTAA
AAGAGGTAGTGAAAGTTCTGCTCTGGCTTAATGCTGCCTTTATGCCAATTTGGGCGGCCGCGTGGGTGTTGCCGTCGGGT
TTTAAAGGCGCGCGCGATGTGCGATTTGCGATGTGGGTATCGATGCTGGGGATGTGGGGCTGTCGCGTTGTGGCAGGGTA
TACGCTTGGTATTGTGCTGGGTATGGGGGTTGTAGGGGTTTGGCTGGGGATGTTTCTTGACTGGGCCGTGCGTGGCGCAC
TGTTTTACTGGCGTCTGATAAGCGGGCGCTGGCTGTGGAGATACCCGCGCGTAAAGAGGGAGTAA