MEGAResFrom MEG, the Microbial Ecology Group

ABEM

The abeM gene encodes a multi-drug efflux pump in Acinetobacter baumannii.

References

  • http://aac.asm.org/content/55/3/947.full

Other Groups in Drug and biocide MATE efflux pumps

Sequences

Download Sequences

>>MEG_372|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pumps|ABEM
GTGTCGAATGTCACGTCGTTTCGGTCTGAATTAAAACAACTCTTCCATTTAATGTTACCTATTTTAATTACGCAGTTTGC
TCAAGCAGGGTTCGGGTTAATTGATACCATTATGGCTGGGCATTTATCTGCCGCAGACTTAGCCGCTATTGCGGTAGGTG
TAGGCTTATGGATTCCAGTCATGCTCTTGTTCAGTGGCATCATGATTGCAACCACACCATTAGTTGCCGAAGCAAAAGGC
GCTAGAAATACAGAGCAAATTCCAGTGATTGTCCGCCAATCATTATGGGTTGCAGTAATTCTAGGGGTATTGGCAATGCT
CATTTTGCAGCTTATGCCATTTTTCTTACATGTGTTTGGCGTACCAGAAAGTTTACAACCTAAAGCCAGTTTATTCTTAC
ATGCAATTGGTTTGGGTATGCCCGCTGTAACCATGTATGCAGCGCTCCGAGGCTATTCCGAAGCATTAGGCCATCCCCGC
CCTGTCACGGTCATTAGCTTACTAGCCTTAGTGGTTTTAATCCCGCTTAACATGATTTTTATGTATGGCTTAGGACCAAT
ACCTGCTTTGGGTAGCGCAGGCTGTGGTTTTGCAACATCCATTTTACAGTGGCTAATGCTCATTACGTTAGCAGGCTATA
TTTATAAGGCTTCGGCTTATCGAAACACATCTATTTTTAGCAGATTCGATAAAATTAGCCTGACTTGGGTTAAAAGAATT
TTACAGCTCGGTCTGCCAATTGGTTTAGCTGTGTTTTTTGAAGTGAGTATTTTTAGTACAGGGGCATTGGTCCTTAGCCC
TCTAGGGGAAGTCTTTATTGCCGCACACCAAGTAGCAATTTCAGTCACTTCGGTACTGTTTATGATTCCACTTTCTCTTG
CCATTGCTTTAACCATTCGCGTGGGGACGTATTATGGTGAAAAGAACTGGGCTTCCATGTACCAAGTACAGAAAATTGGT
CTAAGCACAGCAGTATTTTTTGCTCTATTGACCATGTCTTTTATTGCTTTAGGCCGTGAACAAATTGTCTCGGTTTATAC
TCAAGATATAAATGTTGTGCCGGTTGCCATGTATTTGCTCTGGTTTGCAATGGCATATCAATTAATGGATGCTCTACAAG
TCAGCGCTGCCGGCTGTTTAAGAGGTATGCAAGATACTCAGGCACCGATGTGGATCACCTTAATGGCGTATTGGGTAATT
GCTTTTCCAATCGGTCTTTATTTAGCGCGTTATACCGATTGGGGCGTAGCTGGTGTGTGGTTAGGTTTAATTATTGGTTT
AAGTATTGCCTGTGTTTTATTGCTATCACGACTCTATTTGAATACCAAACGTTTAAGTCAAACCTAA

>>MEG_373|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pumps|ABEM
GTGTCGAATGTCACGTCGTTTCGGTCTGAATTAAAACAACTCTTCCATTTAATGTTACCTATTTTAATTACGCAGTTTGC
TCAAGCAGGGTTCGGGTTAATTGATACCATTATGGCTGGGCATTTATCTGCCGCAGACTTAGCCGCTATTGCGGTAGGTG
TAGGCTTATGGATTCCAGTCATGCTCTTGTTCAGTGGCATCATGATTGCAACCACACCATTAGTTGCCGAAGCAAAAGGC
GCTAGAAATACAGAGCAAATTCCAGTGATTGTCCGCCAATCATTATGGGTTGCAGTAATTCTAGGGGTATTGGCAATGCT
CATTTTGCAGCTTATGCCATTTTTCTTACATGTGTTTGGCGTACCAGAAAGTTTACAACCTAAAGCCAGTTTATTCTTAC
ATGCAATTGGTTTGGGTATGCCCGCTGTAACCATGTATGCAGCGCTCCGAGGCTATTCCGAAGCATTAGGCCATCCCCGC
CCTGTCACGGTCATTAGCTTACTAGCCTTAGTGGTTTTAATCCCGCTTAACATGATTTTTATGTATGGCTTAGGACCAAT
ACCTGCTTTGGGTAGCGCAGGCTGTGGTTTTGCAACATCCATTTTACAGTGGCTGATGCTCATTACGTTAGCAGGCTATA
TTTATAAGGCTTCGGCTTATCGAAACACATCTATTTTTAGCAGATTCGATAAAATTAGCCTGACTTGGGTTAAAAGAATT
TTACAGCTCGGCCTGCCAATTGGTTTAGCTGTGTTTTTTGAAGTGAGTATTTTTAGTACAGGGGCATTGGTCCTTAGCCC
TCTAGGGGAAGTCTTTATTGCCGCACACCAAGTAGCAATTTCAGTCACTTCGGTACTGTTTATGATTCCACTTTCTCTTG
CCATTGCTTTAACCATTCGCGTGGGGACGTATTATGGTGAAAAGAACTGGGCTTCCATGTACCAAGTACAGAAAATTGGT
CTAAGCACAGCAGTATTTTTTGCTCTATTGACCATGTCTTTTATTGCTTTAGGCCGTGAACAAATTGTCTCGGTTTATAC
TCAAGATATAAATGTTGTGCCGGTTGCCATGTATTTGCTCTGGTTTGCAATGGCATATCAATTAATGGATGCTCTACAAG
TCAGCGCTGCCGGCTGTTTAAGAGGTATGCAAGATACTCAGGCACCGATGTGGATCACCTTAATGGCGTATTGGGTAATT
GCTTTTCCAATCGGTCTTTATTTAGCGCGTTATACCGATTGGGGCGTAGCTGGTGTGTGGTTAGGTTTAATTATTGGTTT
AAGTATTGCCTGTGTTTTATTGCTATCACGACTCTATTTGAATACCAAACGTTTAAGTCAAACCTAA