MEGAResFrom MEG, the Microbial Ecology Group

MEPA

The mepA gene encodes a MATE system efflux pump under regulation of MepR.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Other Groups in Drug and biocide MATE efflux pump

Sequences

Download Sequences

>MEG_3833|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pump|MEPA
ATGAAAGACGAACAATTATATTATTTTGAGAAATCGCCAGTATTTAAAGCGATGATGCATTTCTCATTGCCAATGATGAT
AGGGACTTTATTAAGCGTTATTTATGGCATATTAAATATTTACTTTATAGGATTTTTAGAAGATAGCCACATGATTTCTG
CTATCTCTCTAACACTGCCAGTATTTGCTATCTTAATGGGGTTGGGTAATTTATTTGGCGTTGGTGCAGGAACTTATATT
TCACGTTTATTAGGTGCGAAAGACTATAGTAAGAGTAAATTTGTAAGTAGTTTCTCTATTTATGGTGGTATTGCACTAGG
ACTTATCGTGATTTTAGTTACTTTACCATTCAGTGATCAAATCGCAGCAATTTTAGGAGCGAGAGGTGAAACGTTAGCTT
TAACAAGTAATTATTTGAAAGTAATGTTTTTAAGTGCACCTTTTGTAATTTTGTTCTTCATATTAGAACAATTTGCACGT
GCAATTGGGGCACCAATGATTTCTATGATTGGTATGTTAGCTAGTGTAGGCTTAAATATTATTTTAGATCCAATTTTAAT
TTTTGGTTTTGATTTAAACGTTGTTGGTGCAGCTTTGGGTACTGCAATCAGTAATGTTGCTGCTGCTCTGTTCTTTATCA
TTTATTTTATGAAAAATAGTGACGTTGTGTCAGTTAATATTAAACTTGCGAAACCTAATAAAGAAATGCTTTCTGAAATC
TTTAAAATAGGTATTCCTGCATTTTTAATGAGTATCTTAATGGGATTCACAGGATTAGTTTTAAATTTATTTTTAGCACA
TTATGGAAACTTCGCGATTGCAAGTTATGGTATCTCATTTAGACTTGTGCAATTTCCAGAACTTATTATCATGGGATTAT
GTGAAGGTGTTGTACCACTAATTGCATATAACTTTATGGCAAATAAAGGCCGTATGAAAGACGTTATCAAAGCAGTTATC
ATGTCTATCGGCGTTATCTTTGTTGTATGTATGATTGCTGTATTTACAATTGGACATCATATGGTCGGACTATTTACTAC
TGATCAAGCCATTGTTGAGATGGCGACATTTATTTTGAAAGTAACAATGGCATCATTATTATTAAATGGTATAGGTTTCT
TGTTTACTGGTATGCTTCAAGCGACTGGGCAAGGTCGTGGTGCTACAATTATGGCCATTTTACAAGGTGCGATTATCATT
CCAGTATTATTTATTATGAATGCTTTGTTTGGACTAACAGGTGTCATTTGGTCATTATTAATTGCTGAGTCACTTTGTGC
TTTAGCAGCAATGTTAATCGTTTATTTATTACGTGATCGTTTGACAGTTGATACATCTGAATTAATAGAAGGTTAA

>MEG_3834|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pump|MEPA
ATGAAAGACGAACAATTATATTATTTTGAGAAATCGCCAGTATTTAAAGCGATGATGCATTTCTCATTGCCAATGATGAT
AGGGACTTTATTAAGCGTTATTTATGGCATATTAAATATTTACTTTATAGGATTTTTAGAAGATAGCCACATGATTTCTG
CTATCTCTCTAACACTGCCAGTATTTGCTATCTTAATGGGGTTAGGTAATTTATTTGGCGTTGGTGCAGGAACTTATATT
TCACGTTTATTAGGTGCGAAAGACTATAGTAAGAGTAAATTTGTAAGTAGTTTCTCTATTTATGGTGGTATTGCACTAGG
ACTTATCGTGATTTTAGTTACTTTACCATTCAGTGATCAAATCGCAGCAATTTTAGGGGCGAGAGGTGAAACGTTAGCTT
TAACAAGTAATTATTTGAAAGTAATGTTTTTAAGTGCACCTTTTGTAATTTTGTTCTTCATATTAGAACAATTTGCACGT
GCAATTGGGGCACCAATGGTTTCTATGATTGGTATGTTAGCTAGTGTAGGCTTAAATATTATTTTAGATCCAATTTTAAT
TTTTGGTTTTGATTTAAACGTTGTTGGTGCAGCTTTGGGTACTGCAATCAGTAATGTTGCTGCTGCTCTGTTCTTTATCA
TTTATTTTATGAAAAATAGTGACGTTGTGTCAGTTAATATTAAACTTGCGAAACCTAATAAAGAAATGCTTTCTGAAATC
TTTAAAATCGGTATTCCTGCATTTTTAATGAGTATCTTAATGGGATTCACAGGATTAGTTTTAAATTTATTTTTAGCACA
TTATGGAAACTTCGCGATTGCAAGTTATGGTATCTCATTTAGACTTGTGCAATTTCCAGAACTTATTATCATGGGATTAT
GTGAAGGTGTTGTACCACTAATTGCATATAACTTTATGGCAAATAAAGGCCGTATGAAAGACGTTATCAAAGCAGTTATC
ATGTCTATCGGCGTTATCTTTGTTGTATGTATGAGTGCTGTATTTACAATTGGACATCATATGGTCGGACTATTTACTAC
TGATCAAGCCATTGTTGAGATGGCGACATTTATTTTGAAAGTAACAATGGCATCATTATTATTAAATGGTATAGGTTTCT
TGTTTACTGGTATGCTTCAAGCGACTGGGCAAGGTCGTGGTGCTACAATTATGGCCATTTTACAAGGTGCAATTATCATT
CCAGTATTATTTATTATGAATGCTTTGTTTGGACTAACAGGTGTCATTTGGTCATTATTAATTGCTGAGTCACTTTGTGC
TTTAGCAGCAATGTTAATCGTCTATTTATTACGTGATCGTTTGACAGTTGATACATCTGAATTAATAGAAGGTTAA

>MEG_3835|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MATE_efflux_pump|MEPA
AAGGAGTATTGAACAATGAAAGACGAACAATTATATTATTTTGAGAAATCGCCAGTATTTAAAGCGATGATGCATTTCTC
ATTGCCAATGATGATAGGGACTTTATTAAGCGTTATTTATGGCATATTAAATATTTACTTTATAGGATTTTTAGAAGATA
GCCACATGATTTCTGCTATCTCTCTAACACTGCCAGTATTTGCTATCTTAATGGGGTTAGGTAATTTATTTGGCGTTGGT
GCAGGAACTTATATTTCACGTTTATTAGGTGCGAAAGACTATAGTAAGAGTAAATTTGTAAGTAGTTTCTCTATTTATGG
TGGTATTGCACTAGGACTTATCGTGATTTTAGTTACTTTACCATTCAGTGATCAAATCGCAGCAATTTTAGGGGCGAGAG
GTGAAACGTTAGCTTTAACAAGTAATTATTTGAAAGTAATGTTTTTAAGTGCACCTTTTGTAATTTTGTTCTTCATATTA
GAACAATTTGCACGTGCAATTGGGGCACCAATGGTTTCTATGATTGGTATGTTAGCTAGTGTAGGCTTAAATATTATTTT
AGATCCAATTTTAATTTTTGGTTTTGATTTAAACGTTGTTGGTGCAGCTTTGGGTACTGCAATCAGTAATGTTGCTGCTG
CTCTGTTCTTTATCATTTATTTTATGAAAAATAGTGACGTTGTGTCAGTTAATATTAAACTTGCGAAACCTAATAAAGAA
ATGCTTTCTGAAATCTTTAAAATCGGTATTCCTGCATTTTTAATGAGTATCTTAATGGGATTCACAGGATTAGTTTTAAA
TTTATTTTTAGCACATTATGGAAACTTCGCGATTGCAAGTTATGGTATCTCATTTAGACTTGTGCAATTTCCAGAACTTA
TTATCATGGGATTATGTGAAGGTGTTGTACCACTAATTGCATATAACTTTATGGCAAATAAAGGCCGTATGAAAGACGTT
ATCAAAGCAGTTATCATGTCTATCGGCGTTATCTTTGTTGTATGTATGAGTGCTGTATTTACAATTGGACATCATATGGT
CGGACTATTTACTACTGATCAAGCCATTGTTGAGATGGCGACATTTATTTTGAAAGTAACAATGGCATCATTATTATTAA
ATGGTATAGGTTTCTTGTTTACTGGTATGCTTCAAGCGACTGGGCAAGGTCGTGGTGCTACAATTATGGCCATTTTACAA
GGTGCAATTATCATTCCAGTATTATTTATTATGAATGCTTTGTTTGGACTAACAGGTGTCATTTGGTCATTATTAATTGC
TGAGTCACTTTGTGCTTTAGCAGCAATGTTAATCGTCTATTTATTACGTGATCGTTTGACAGTTGATACATCTGAATTAA
TAGAAGGTTAA