MEGAResFrom MEG, the Microbial Ecology Group

NOVA

The novA gene encodes a type III bacterial ABC transporter that is implicated in the active extrusion of novobiocin, an Aminocoumarin antibiotic. Removal of the antibiotic results in resistance to the drug.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12604514

Other Groups in Drug and biocide ABC efflux pump

Sequences

Download Sequences

>MEG_4216|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_ABC_efflux_pump|NOVA
ATGAAGTCCGCACTCTCGACCTGGAAGCCCTCGGACCGGCCGCCGGATCCGACACTGCCCGAGCCGCCGGCCCAGCTGCG
CCGCATCTTCCGGCTCTTCCGCCCGTACCGCGGCAGGCTCGCCGTCGTCGGCCTGCTCGTCGGCGCCTCGTCGCTGGTGG
CCGTCGCCTCGCCGTTCATGCTGCGCGAGATCCTCGACACCGCGATCCCGCAGGGCCGCACCGGGCTGCTCAGCCTGCTC
GCCCTCGGCATGATCCTGACCGCCGTCCTCAGCAGCGTCTTCGGCGTCGTCCAGACCCTCATCTCCACGACGGTCGGCCA
GCGCGTCATGCACGACCTGCGCACCGCCGTCTACGCGCAGCTCCAGCGCATGCCCCTCGCGTTCTTCACCCGCACCCGCA
CCGGTGAGGTCCAGTCCCGGATAGCCAACGACATCGGCGGCATGCAGGCGACCGTCACCTCAACCGCCACGTCGCTGGTC
TCCAACCTCACCGCCGTCATCGCCACCGTCGTCGCGATGCTCGCGCTGGACTGGCGGCTGACCGTCGTCTCGCTGCTCCT
GCTGCCGGTGTTCGTCTGGATCAGCCGCCGCGTCGGCCGTGAGCGCAAACGGATCACCCTGCAACGGCAGAAGCAGATGG
CCACGATGGCCGCCACGGTCACGGAGTCGCTGTCGGTCAGCGGCATCCTCCTCGGCCGCACGATGGGGCGCGCCGACTCG
CTCACCAGATCCTTCGCCGAGGAGTCCGAGCGACTCGTCGACCTGGAGGTCCGCTCCAACATGGCCGGGCGGTGGCGGAT
GTCCGTCATCGGCATCGTCATGGCCGCCATGCCCGCCGTCATCTACTGGGCGGCCGGCTTCGTCCTCCAGTCCGGCGGCA
CGGTCGTCTCCATCGGCACACTCGTCGCCTTCGTCTCCCTCCAGCAGGGCCTCTTCCGCCCGGCCGTGAGCCTGCTCGCC
ACCGGCGTGCAGATGCAGACGTCCCTCGCGCTCTTCCAGCGCATCTTCGAATATCTCGACCTGCCCGTCGACATCACCGA
ACCCGAGCGTCCGGTGGCCCTCGACAAGGTCCGGGGCGAAGTGCGCTTCGACGGCGTCGACTTCAGTTACGAGGAGAAGG
ACGGCAACACCCTCCACGGCCTGGATCTGACCGTCCCGGCCGGCGGCAGCCTCGCCGTCGTCGGTCCCACCGGATCGGGC
AAGTCGACCCTGAGCTATCTCGTGCCGCGTCTGTACGACGTGACGGGCGGCCGGGTCCTGCTCGACGGCGTCGACGTACG
CGACCTGGCCTTCGACACCCTCGCCCGCGCGGTGGGCGTCGTGTCGCAGGAGACGTATCTCTTCCACGCCTCCGTCGCCG
ACAACCTCCGCTTCGCCAAACCGGACGCGACGGACGAGGAGATCGAGAAGGCGGCCAGGGCCGCCCAGATCCACGAGCAC
ATCGTCACCCTGCCCGACGGGTACGACACACTGGTCGGCGAGCGCGGATACCGGTTCTCCGGCGGCGAGAAACAGCGCCT
CGCGATCGCCCGCACCATCCTGCGCGACCCGCCCGTCCTCGTGCTGGACGAGGCGACGAGCGCGCTCGACACCCGTACCG
AACACGCGGTCCAGCAGGCCATCGACTCCCTCTCCGAGGGCCGTACGACCATCACCATCGCCCACCGGCTCTCCACGGTG
CGCGACGCCGACCAGATCGTCGTCCTCGACGCCGGTCGCATAGCCGAGCGCGGCACGCACGAGGAGCTGATCGACCGGGA
CGGCAGGTACGCGGCGCTCGTCCGCCGGGACGGCGCGCCGGCGCCCGCGCCCGTGCCCGCCCGGGACGAGCGCGTGGGCG
CCGCCTGA