MEGAResFrom MEG, the Microbial Ecology Group

MACB

The macB gene encodes an efflux pump that has been shown to function on macrolides.

References

  • http://jac.oxfordjournals.org/content/56/5/856.full.pdf

Other Groups in Drug and biocide ABC efflux pump

Sequences

Download Sequences

>MEG_3660|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_ABC_efflux_pump|MACB
ATGAGCTTGATCGAATGTAAAAACATCAACCGCTATTTCGGCAGCGGCGAGAACCGCGTCCATATTTTGAAAGACATCAG
CCTGTCGATAGAGAAGGGTGATTTTGTCGCCATCATCGGGCAGTCCGGTTCGGGCAAGTCCACGCTGATGAACATACTCG
GTTGTTTGGATACCGCCGGTTCCGGTTCGTACCGAATCGACGGCATCGAAACTGCCAAAATGCAGCCTGACGAACTGGCG
GCATTGCGGCGCGAACGCTTCGGTTTCATCTTCCAACGCTACAACCTCTTAAGCTCGCTGACCGCAAGGGACAACGTCGC
GCTGCCAGCCGTGTATATGGGTATGGGAGGCAAAGAGCGTTCCGCGCGGGCGGACAAACTCTTGCAGGATTTGGGTTTGG
CAAGTAAAGAGGGCAACAAGCCCGGCGAACTCTCGGGCGGACAGCAGCAGCGCGTCTCCATCGCCCGCGCCCTGATGAAC
GGCGGAGAAATCATCTTCGCCGACGAGCCGACCGGCGCACTCGATACCGCCAGCGGCAAAAATGTGATGGAAATCATCCG
CAGGCTGCACGAAGCCGGGCATACCGTCATTATGGTCACGCACGACCCCGGCATTGCCGCCAATGCCAACCGCGTCATCG
AAATCCGGGACGGCGAAATCATTTCCGACACCTCGAAAAATCCCGAAATCCCCGCAAGCAATGTCGGGAGGATTCAGGAA
AAAGCCTCGTGGTCGTTTTATTACGACCAGTTTGTCGAAGCCTTCAGAATGTCGGTGCAAGCAGTATTGGCGCACAAAAT
GCGTTCGCTTCTGACCATGCTCGGCATCATCATCGGTATCGCTTCGGTTGTCTCCGTCGTCGCGCTGGGCAACGGGTCGC
AGAAAAAAATCCTCGAAGACATCAGTTCGATGGGGACGAACACCATCAGCATCTTCCCCGGGCGCGGCTTCGGCGACAGG
CGCAGCGGCAAAATCAAAACCCTGACCATAGACGACGCAAAAATCATCGCCAAACAAAGCTATGTTGCTTCCGCCACGCC
CATGACTTCGAGCGGCGGCACGCTGACCTACCGCAATACCGACCTGACCGCTTCTTTGTACGGCGTGGGCGAACAATATT
TCGACGTGCGCGGGCTGAAGCTGGAAACGGGGCGGCTGTTTGATGAGAACGATGTGAAAGAAGACGCGCAAGTCGTCGTC
ATCGACCAAAATGTCAAAGACAAACTCTTTGCGGACTCGGATCCGTTGGGTAAAACCATTTTGTTCAGGAAACGCCCCTT
GACCGTCATCGGCGTGATGAAAAAAGACGAAAACGCTTTCGGCAATTCCGACGTGCTGATGCTTTGGTCGCCCTATACGA
CGGTGATGCACCAAATCACAGGCGAGAGCCACACCAACTCCATCACCGTCAAAATCAAAGACAATGCCAATACCCGGGTT
GCCGAAAAAGGGCTGGCCGAGCTGCTCAAAGCACGGCACGGCACGGAAGACTTCTTTATGAACAACAGCGACAGCATCAG
GCAGATGGTCGAAAGCACCACCGGTACGATGAAGCTGCTGATTTCCTCCATCGCCCTGATTTCATTGGTAGTCGGCGGCA
TCGGCGTGATGAACATTATGCTGGTGTCCGTTACCGAGCGCACCAAAGAAATCGGCATACGGATGGCAATCGGCGCGCGG
CGCGGCAATATTTTGCAGCAGTTTTTGATTGAGGCGGTGTTAATCTGCATCATCGGAGGCTTGGTCGGCGTAGGTTTGTC
CGCCGCCGTCAGCCTCGTGTTCAATCATTTTGTAACCGATTTCCCGATGGACATTTCGGCGGCATCCGTTATCGGGGCGG
TCGCCTGTTCGACCGGAATCGGCATCGCGTTCGGCTTTATGCCTGCCAATAAGGCAGCCAAACTCAATCCGATAGACGCA
TTGGCGCAGGATTGA