MEGAResFrom MEG, the Microbial Ecology Group

LMRB

Efflux pumps are a common mechanism of resistance to antibiotics. The antibiotic must reach its target to be effective, and efflux pumps can actively transport the substance out of the bacterial cell, causing resistance by evasion of the drug. The lmrB gene encodes a lincomycin-specific efflux pump in Bacillus subtilis.

References

  • http://jac.oxfordjournals.org/content/56/1/20.full

Other Groups in Drug and biocide ABC efflux pump

Sequences

Download Sequences

>MEG_3596|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_ABC_efflux_pump|LMRB
TTGGAAACAACAGCTAAAGCATCTCAGCAATACAAAGTGATGCCGATTATGATTTCCTTGCTGTTGGCCGGTTTTATCGG
CATGTTCAGTGAAACAGCGCTGAATATTGCGTTAACCGACCTTATGAAGGAATTGAACATTACAGCGGCAACCGTCCAAT
GGTTAACGACGGGCTACCTGCTTGTACTCGGTATCCTTGTTCCTGTTTCAGGACTGCTGTTGCAGTGGTTCACAACAAGA
CAGCTTTTTACCGTGTCACTTATCTTTTCAATTTTAGGTACATTCATTGCGGCGCTTGCGCCGAGCTTCTCGTTTTTATT
AGCGGCAAGGATCGTTCAGGCACTTGGAACCGGTCTTTTACTGCCGCTGATGTTTAACACAATCTTGGTGATTTTCCCGC
CTCATAAACGGGGTGCCGCAATGGGAACGATCGGGCTTGTCATTATGTTCGCGCCCGCCATCGGCCCAACTTTCTCAGGA
TTGGTTCTGGAGCATCTCAACTGGCACTGGATTTTCTGGATCTCTCTTCCATTCCTTGTGCTGGCGCTTGTTTTCGGTAT
CGCATATATGCAAAATGTATCTGAAACGACAAAGCCGAAAATCGATGTATTGTCTATCATCCTGTCGACGATTGGCTTCG
GCGGCATTGTATTCGGATTCAGCAACGCGGGTGAAGGCTCCGGGGGATGGTCCAGCCCGACTGTTATCGTGTCGCTGATT
GTCGGCGTTGTCGGCCTTATCTTATTTTCAATCCGCCAGCTGACAATGAAGCAGCCTATGATGAACCTCCGTGCGTTCAA
ATACCCGATGTTTATTTTGGGTGTGATCATGGTGTTCATTTGTATGATGGTCATTCTGTCATCTATGCTGCTTCTGCCGA
TGTATCTGCAAGGCGGCTTAGTCCTCACTGCATTTGCATCTGGTCTTGTTCTCTTGCCGGGCGGTATTTTAAATGGATTT
ATGTCCCCTGTTACAGGCCGCTTGTTCGATAAATACGGGCCGAAATGGCTTGTCATTCCGGGATTTGTGATTGTCACCGT
TGTACTATGGTTCTTCTCAAATGTCACGACCACTTCAACAGCTGTGCTGATTATCATCCTGCACACCTGCTTGATGATCG
GGATTTCTATGATCATGATGCCTGCACAGACAAACGGTTTAAACCAACTGCCGCGTGAATTTTATCCAGACGGCACCGCC
ATTATGAACACGCTGCAGCAAATGGCCGGCGCTATCGGAACAGCGGTTGCGGTCAGCATTATGGCTGCAGGCCAGCATGA
TTATATGAGTACAGTTAAAAACCCTGCCGATCCGGCAGTCATCCCGCAAGCTTTGACAGCAGGCGTACAGCACGCATTTG
TGTTTGCAATGATTGTTGCCATTATCGGTTTAATTGGCGCTTTCTTTATGAAACGCGTTAAAGTAGATCATTAA