MEGAResFrom MEG, the Microbial Ecology Group

SOXS

The soxS gene encodes a AraC family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Sequences

Download Sequences

>>MEG_6551|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_resistance_regulator|SOXS
ATGTCCCATCAGAAAATTATTCAGGATCTTATCGCATGGATTGACGAGCATATTGACCAGCCGCTTAACATTGATGTAGT
CGCAAAAAAATCAGGCTATTCAAAGTGGTACTTGCAACGAATGTTCCGCACGGTGACGCATCAGACGCTTGGCGATTACA
TTCGCCAACGCCGCCTGTTACTGGCCGCCGTTGAGTTGCGCACCACCGAGCGTCCGATTTTTGATATCGCAATGGACCTG
GGTTATGTCTCGCAGCAGACCTTCTCCCGCGTTTTCCGTCGGCAGTTTGATCGCACTCCCAGCGATTATCGCCACCGCCT
GTAA

>>MEG_6552|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_resistance_regulator|SOXS|RequiresSNPConfirmation
ATGTCGCATCAGCAGATAATTCAGACCCTTATCGAATGGATTGATGAACATATCGACCAACCGCTAAACATTGATGTGGT
GGCAAAAAAATCGGGCTACTCCAAGTGGTATTTGCAGCGGATGTTTCGTACGGTAACGCATCAAACATTAGGCGAGTATA
TTCGCCAGCGCCGTCTCCTGTTGGCGGCCGTTGAGCTACGAACGACCGAGCGCCCGATTTTTGATATCGCGATGGACCTG
GGCTATGTATCGCAGCAAACCTTCTCGCGTGTATTCCGCCGCGAGTTCGATCGCACTCCCAGCGATTACCGTCACCGCCT
GTAG