MEGAResFrom MEG, the Microbial Ecology Group

CMER

The cmeR gene encodes a repressor of the cmeABC multi-drug efflux systme in Campylobacter.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/15728904

Other Groups in Drug and biocide and metal RND efflux regulator

Sequences

Download Sequences

>>MEG_1747|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_RND_efflux_regulator|CMER
ATGAACTCAAATAGAACACCATCACAAAAAGTTTTAGCCAGACAAGAAAAAATCAAAGCAGTGGCCTTAGAGCTTTTTTT
AACAAAAGGATACCAAGAAACAAGTTTGAGTGATATTATTAAATTATCTGGAGGATCTTATTCTAATATTTATGATGGTT
TTAAAAGTAAAGAAGGGCTATTCTTTGAAATTTTAGATGACATATGTAAAAAACACTTTCATCTTATTTATTCCAAAACA
CAAGAAATTAAAAATGGCACTTTAAAAGAAATTTTAACTTCTTTTGGTTTAGCTTTTATAGAAATTTTCAATCAACCAGA
AGCTGTAGCCTTTGGTAAAATTATCTATTCTCAAGTTTATGACAAAGATAGACATCTTGCCAATTGGATAGAAAATAATC
AACAAAATTTTTCCTATAACATACTTATGGGTTTTTTCAAGCAACAAAATAATTCTTATATGAAAAAAAATGCAGAAAAA
CTTGCTGTTCTTTTTTGCACTATGTTAAAAGAACCTTATCACCATCTTAATGTTTTAATTAACGCTCCTTTGAAAAATAA
AAAAGAACAAAAAGAACATGTTGAATTTGTTGTAAATGTTTTTCTAAATGGAATCAATAGCTCCAAAGCTTAA

>>MEG_1748|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_RND_efflux_regulator|CMER
ATGAACTCAAATAGAACACCATCACAAAAAGTTTTAGCCAGACAAGAAAAAATCAAAGCAGTGGCCTTAGAGCTTTTTTT
AACAAAAGGATACCAAGAAACAAGTTTGAGTGATATTATTAAATTATCTGGAGGATCTTATTCTAATATTTATGATGGTT
TTAAAAGTAAAGAAGGGCTATTCTTTGAAATTTTAGATGACATATGTAAAAAACACTTTCATCTTATTTATTCCAAAACA
CAAGAAATTGAAAATGGCACTTTAAAAGAAATTTTAACTTCTTTTGGTTTAGCTTTTATAGAAATTTTCAATCAACCAGA
AGCTGTAGCTTTTGGTAAAATTATCTATTCTCAAGTTTATGACAAAGATAGACATCTTGCCAATTGGATAGAAAATAATC
AACAAAATTTTTCCTATAACATACTTATGGGTTTTTTCAAGCAACAAAATAATTCTTATATGAAAAAAAATGCAGAAAAA
CTTGCTGTTCTTTTTTGCACTATGTTAAAAGAACCTTATCATCATCTTAATGTTTTAATTAACGCTCCTTTGAAAAATAA
AAAAGAACAAAAAGAACATGTTGAATTTGTTGTAAATGTTTTTCTAAATGGAATCAATAGCTCCAAAGCTTAA