Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

BAES

The baeRS encode a response regulator system that controls the expression of the mdtABC multi-drug transporter.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12107133

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Drug and biocide and metal RND efflux regulator

Sequences

Download Sequences

>>MEG_1193|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_RND_efflux_regulator|BAES
ATGAAGTTCTGGCGACCCGGTATTACCGGCAAACTGTTTCTGGCGATTTTCGCCACCTGCATTGTCTTGCTGATCAGTAT
GCACTGGGCGGTGCGTATCAGTTTTGAGCGTGGCTTTATTGATTACATCAAGCATGGTAATGAACAGCGATTACAACTGT
TAAGTGATGCGCTTGGCGAGCAGTATGCGCAGCATGGCAACTGGCGCTTCCTGCGCAACAATGATCGCTTTGTCTTTCAG
ATCCTGCGTTCATTTGAACACGATAATTCGGAAGATAAACCCGGCCCGGGTATGCCACCGCACGGCTGGCGTACCCAGTT
CTGGGTGGTTGATCAAAACAACAAAGTGCTGGTTGGTCCGCGAGCGCCGATTCCACCTGACGGTACACGGCGACCCATTC
TGGTCAACGGTGCGGAAGTTGGCGCGGTGATCGCCTCCCCCGTTGAGCGGTTAACGCGCAATACTGATATCAATTTCGAT
AAACAACAGCGGCAAACCAGCTGGTTGATTGTCGCCCTGGCAACGTTACTCGCGGCACTTGCCACTTTTCTGCTGGCGCG
CGGTTTACTGGCACCGGTAAAACGACTTGTCGATGGCACGCACAAACTGGCGGCGGGCGATTTCACTACCCGCGTAACGC
CCACCAGTGAAGATGAACTGGGCAAACTGGCGCAAGACTTCAACCAGCTTGCCAGCACACTGGAGAAAAACCAGCAAATG
CGGCGCGATTTTATGGCCGATATTTCTCACGAACTGCGTACGCCATTAGCGGTGCTGCGCGGTGAACTGGAAGCCATTCA
GGATGGCGTGCGTAAATTCACGCCGGAGACGGTGGCGTCTTTACAGGCGGAGGTCGGTACACTGACCAAACTGGTTGACG
ATCTCCATCAGTTGTCGATGTCTGATGAAGGCGCTCTCGCCTATCAAAAAGCACCGGTAGATTTGATCCCACTGCTGGAA
GTGGCGGGCGGCGCATTTCGCGAACGATTCGCCAGTCGTGGCCTGAAACTGCAATTTTCCCTGCCAGACAGTATTACCGT
ATTTGGCGATCGCGACCGTTTAATGCAGTTATTCAATAACTTACTGGAAAACAGCCTGCGCTACACTGACAGCGGCGGCA
GCCTGCAAATCTCTGCCGGGCAGCGCGACAAAACGGTGCGCCTGACCTTTGCCGACAGTGCGCCAGGTGTCAGTGACGAT
CAGCTACAAAAATTGTTTGAACGTTTTTATCGCACCGAAGGTTCCCGCAACCGTGCCAGCGGCGGTTCCGGGCTGGGGCT
GGCGATTTGCCTGAACATTGTTGAAGCACATAATGGTCGCATTATTGCTGCCCATTCGCCTTTTGGCGGGGTAAGCATTA
CAGTAGAGTTACCGCTGGAACGGGATTTACAGAGAGAAGTATGA

>>MEG_1194|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_RND_efflux_regulator|BAES
ATGAAAGTCTGGCGGCCCGGAATCACCGGCAAGCTGTTTCTGGCGATCTTCGCCACCTGCATCGTGCTGCTGATCAGTAT
GCATTGGGCCGTGCGCGTCAGTTTTGAACGCGGATTTATTGACTATATCAAACACGGCAACGAGCAGCGGCTACAAATGC
TGGGCGATGCGCTGGGCGACCAGTACCAGCAACACGGCAACTGGCGTTTTTTACGCAACAACGATCGCTTCGTTTTCCAG
ATTTTGCGTTCATTTGAGCATGACAACGACCGCGATAAACCCGGCCCCGGTATGCCGCCGCACGGTTGGCGCACCCAATT
CTGGGTCGTCGATCAAAATGGCCGGGTGCTGGTCGGCCCACGCGGTCCGGTGCCGCATGACGGTACTCGCCGTCCCATTC
TGGTCAATGACGTCGAAGTCGGCGCGATTATCGCCTCTCCTGTCGAGCGGCTGACGCGCAATACGGATATTAATTTTGAT
ATGCAGCAGCGGCGCGCCAGTTGGATGATCGTGGCGTTATCAACGTTGCTGGCCGCGCTGGCGACATTTTTGCTGGCGCG
TGGCCTGCTCGCCCCGGTCAAACGGTTGGTCGAAGGTACGCACAGACTGGCGGCGGGGGATTTTACCACGCGCGTGACTC
CAACCAGCGCTGATGAGCTGGGAAAACTGGCGCAGGACTTTAACCAGCTTGCCAGCACGCTGGAAAAAAACCAGCAGATG
CGCCGCGACTTTATGGCGGATATTTCCCACGAACTGCGCACGCCGCTGGCGGTATTGCGCGGCGAACTTGAAGCCATTCA
GGATGGCGTTCGCCAGTTCACGCCAGAATCGGTTACCTCGCTACAGGCGGAAGTCGGTACGCTTACCAAACTGGTTGACG
ACCTGCATCAGCTGTCGTTGTCTGACGAGGGCGCGCTGGCTTACCAAAAAACGACCGTCGATCTTGTTCCCCTGTTGGAA
GTCGCTGGCGGCGCGTTCAGAGAGCGCTTTACCAGCCGGGGGCTAACGCTACATTACGCGTTGCCGGATAGTATGACCGT
CTTCGGCGACCCGGATCGCCTGATGCAACTGTTTAATAATCTACTGGAAAACAGTCTGCGCTACACCGACAGCGGCGGCG
GCCTGCATATTTCCGCCGAACAACGCGACAAATCATTATTCCTGACCTTTGCCGATTCTGCACCGGGCGTCAGCGATGAA
CAGTTACAAAAGCTTTTTGACCGTTTTTACCGCACGGAAGTGTCCCGTAACCGCGCCAGCGGCGGTTCTGGACTGGGGCT
GGCAATATGCGTCAATATTGTACACGCGCATAACGGTCATCTTCACGCCGCTCATTCGCCTTTTGGCGGGGTTAGCATTA
CAGTAGAGTTACCGCTGGATCGCGATTTACAGAGAGAAGTATGA

>>MEG_1195|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_RND_efflux_regulator|BAES
ATGAAGTTCTGGCGACCCGGTATTACCGGCAAACTGTTTCTGGCGATTTTCGCCACCTGCATTGTCTTGCTGATCAGTAT
GCACTGGGCGGTGCGTATCAGTTTTGAGCGTGGCTTTATTGATTACATCAAGCATGGTAATGAACAGCGATTACAACTGT
TAAGTGATGCGCTTGGCGAGCAGTATGCGCAGCATGGCAACTGGCGCTTCCTGCGCAACAATGATCGCTTTGTCTTTCAG
ATCCTGCGTTCATTTGAACACGATAATTCGGAAGATAAACCCGGCCCGGGTATGCCACCGCACGGCTGGCGTACCCAGTT
CTGGGTGGTTGATCAAAACAACAAAGTGCTGGTTGGTCCGCGAGCGCCGATTCCACCTGACGGTACACGGCGACCCATTC
TGGTCAACGGTGCGGAAGTTGGCGCGGTGATCGCCTCCCCCGTTGAGCGGTTAACGCGCAATACTGATATCAATTTCGAT
AAACAACAGCGGCAAACCAGCTGGTTGATTGTCGCCCTGGCAACGTTACTCGCGGCACTTGCCACTTTTCTGCTGGCGCG
CGGTTTACTGGCACCGGTAAAACGACTTGTCGATGGCACGCACAAACTGGCGGCGGGCGATTTCACTACCCGCGTAACGC
CCACCAGTGAAGATGAACTGGGCAAACTGGCGCAAGACTTCAACCAGCTTGCCAGCACACTGGAGAAAAACCAGCAAATG
CGGCGCGATTTTATGGCCGATATTTCTCACGAACTGCGTACGCCATTAGCGGTGCTGCGCGGTGAACTGGAAGCCATTCA
GGATGGCGTGCGTAAATTCACGCCGGAGACGGTGGCGTCTTTACAGGCGGAGGTCGGTACACTGACCAAACTGGTTGACG
ATCTCCATCAGTTGTCGATGTCTGATGAAGGCGCTCTCGCCTATCAAAAAGCACCGGTAGATTTGATCCCACTGCTGGAA
GTGGCGGGCGGCGCATTTCGCGAACGATTCGCCAGTCGTGGCCTGAAACTGCAATTTTCCCTGCCAGACAGTATTACCGT
ATTTGGCGATCGCGACCGTTTAATGCAGTTATTCAATAACTTACTGGAAAACAGCCTGCGCTACACTGACAGCGGCGGCA
GCCTGCAAATCTCTGCCGGGCAGCGCGACAAAACGGTGCGCCTGACCTTTGCCGACAGTGCGCCAGGTGTCAGTGACGAT
CAGCTACAAAAATTGTTTGAACGTTTTTATCGCACCGAAGTTCCCGCAACCGTGCCAGCGGGTTCCGGGCTGGGGCTGGC
GATTTGCCTGAACATTGTTGAAGCACATAATGGTCGCATTATTGCTGCCCATTCGCCTTTTGGCGGGGTAAGCATTACAG
TAGAGTTACCGCTGGAACGGGATTTACAGAGAGAAGTATGA