MEGAResFrom MEG, the Microbial Ecology Group

ROBA

The robA gene encodes a transcriptional regulator that is linked to multi-drug resistance through the AcrAB efflux system in Escherichia coli.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/9343820

Other Groups in Drug and biocide and metal RND efflux pumps

Sequences

Download Sequences

>>MEG_6082|Multi-compound|Drug_and_biocide_and_metal_resistance|Drug_and_biocide_and_metal_RND_efflux_pumps|ROBA
ATGGATCAGGCCGGCATTATTCGCGACCTTTTAATCTGGCTGGAAGGTCATCTGGATCAGCCCCTGTCGCTCGACAATGT
AGCGGCGAAAGCAGGTTATTCCAAGTGGCACTTACAGAGAATGTTTAAAGATGTCACTGGCCATGCTATTGGCGCGTATA
TTCGTGCTCGTCGTTTGTCGAAATCGGCGGTCGCACTACGCCTGACTGCGCGTCCGATTCTGGACATCGCGCTGCAATAC
CGCTTCGACTCTCAACAGACATTTACCCGCGCATTCAAGAAGCAGTTTGCCCAGACTCCTGCACTTTACCGCCGTTCTCC
TGAATGGAGCGCCTTTGGTATTCGCCCGCCGCTACGCCTGGGTGAATTCACTATGCCAGAGCACAAATTTGTCACCCTGG
AAGATACGCCGCTGATTGGTGTTACCCAGAGCTACTCCTGTTCGCTGGAGCAAATCTCTGATTTCCGCCATGAAATGCGT
TATCAGTTCTGGCACGATTTTCTCGGCAACGCGCCGACCATTCCGCCGGTGCTCTACGGCCTGAATGAAACGCGTCCGAG
TCAGGATAAAGACGACGAGCAAGAGGTATTCTATACCACCGCGTTAGCCCAGGATCAGGCAGATGGCTATGTACTGACGG
GGCATCCGGTGATGCTGCAGGGCGGCGAATATGTGATGTTTACCTATGAAGGTCTGGGAACCGGCGTGCAGGAGTTTATC
CTGACGGTATACGGAACGTGCATGCCAATGCTCAACCTGACGCGCCGTAAAGGTCAGGATATTGAGCGATACTACCCGGC
AGAAGATGCCAAAGCGGGAGATCGCCCAATTAATCTACGCTGTGAACTGCTGATTCCGATCCGTCGTTAA