Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

CRDS

The CRDS group of genes confer resistance to Copper resistance through the mechanism, Copper resistance regulator.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Copper resistance regulator

    Sequences

    Download Sequences

    >>MEG_2128|Metals|Copper_resistance|Copper_resistance_regulator|CRDS
    TTGGCTATCGCTTTAACCCACTATGAAAAAAAATCCCTTAAACTCTTTTTAGGGATTTATTTAGGCTCTTCGTTTGTGTT
    GATGCTAGTGATTAGCGTTTTAGCGTTTAACTATGAAAAAAACGAAAAAATCAAAATGATACGCATGGACATGGACAAAA
    TGGCTTCTAAGATCGCTAGCGAAGTGATTGCCTTGCACATGCAAACGCATGGGGATTATCAAAACGCTTTAAACGCTCTC
    ATTTCACGCTATAAAGACGCTTCCATAGCCCTTTTTGATAGTAAAAAGCGTGTTTTGTATTCTAATATCCCTGAAAGCGC
    CAATTTGATTAAAAACCATAAAGAAGCGGGCTTTTTTAGTTTTAGGGGAGAGTATTACCTATTGAGCGATGAAACTTTCG
    CTCACTTAGGCGTGGCTAAAATGCTTTTTAAAAATTCTAAACCCCTTCATTTTTCTTCTTTGTATCGTAACATTGTTTTA
    GTGTTTGTTGTAGCGTTTTTATGCGTGATAGGGGTTTCTGTGTTTTTGGGGCGTTTGTTTTTAAAGCCCATTAGGAATGA
    AATCACCCGCATTGATCATTTTTTAAAAAACACCACGCATGAATTAAACACCCCCATGAGCGCTTTAGTCTTGTCTTTAA
    AAACCTTAGAAGACAACCAACAACACCGCCGCATTAAAATCGCTATCCAGCGCATGAGTTTTTTATACCGCTCGCTCTCG
    TATTTAGTGATGCAAGATATTGAGCGCGAATCTTTTGTGCTTTTAGATTTAAAAGCCCTGATTATTAAAGAAAACACGCT
    TTTTAGCGAGATGATAGACTACCACAAGCTGGAATTTAAAAGCGATTTAGTGGAAGTGGAACTTAAAGCTAAAGAGCAGG
    ATTTCATTTCGCTTTATAGCAATTTGCTCATGAACGCGATCAAATACAGCGTCATGAATGGGTATATCCACATAGAGCTA
    ACGCATGCGTTTTTGAAAGTGAAAAATTTAGGGTATGAAATCCCTAAAGACAAGATCACAGAATTAAGCGTTCGTTATGT
    GCGTTTCAATTCTGGCGTGTTGGGTTATGGTATAGGGTTAGGTTTGGTGAAAAAAGTGTGCGAAAAGTATAAAATGCGTT
    TAGAAATTCATAGCGAACCCTCTTTAAAGGGATCGTTTTATGAAAATTCGTTTTGCGTTCAATTTCAAGGATAA