Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

NFSA

The NFSA group of genes confer resistance to Chromium resistance through the mechanism, Chromium resistance protein.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Chromium resistance protein

    Sequences

    Download Sequences

    >>MEG_4160|Metals|Chromium_resistance|Chromium_resistance_protein|NFSA
    ATGACGCCAACCATTGAACTTATTTGTGGCCATCGCTCCATTCGCCATTTCACTGATGAACCCATTTCCGAAGCGCAGCG
    TGAGGCGATTATTAACAGCGCCCGTGCGACGTCCAGTTCCAGTTTTTTGCAGTGCAGTAGCATTATTCGCATTACCGACA
    AAGCGTTACGTGAAGAACTGGTGACGCTGACCGGCGGGCAAAAACACGTAGCGCAAGCGGCGGAGTTCTGGGTGTTCTGT
    GCCGACTTTAACCGCCATTTACAGATCTGTCCGGATGCTCAGCTCGGCCTGGCGGAACAACTGTTGCTCGGTGTCGTTGA
    TACGGCAATGATGGCGCAGAATGCATTAATCGCAGCGGAATCGCTGGGATTGGGCGGGGTATATATCGGCGGCCTGCGCA
    ATAATATTGAAGCGGTGACGAAACTGCTTAAATTACCGCAGCATGTTCTGCCGCTGTTTGGGCTGTGCCTTGGCTGGCCT
    GCGGATAATCCGGATCTTAAGCCGCGTTTACCGGCCTCCATTTTGGTGCATGAAAACAGCTATCAACCGCTGGATAAAGG
    CGCACTGGCGCAGTATGACGAGCAACTGGCGGAATATTACCTCACCCGTGGCAGCAATAATCGCCGGGATACCTGGAGCG
    ATCATATCCGCCGAACAATCATTAAAGAAAGCCGCCCATTTATTCTGGATTATTTGCACAAACAGGGTTGGGCGACGCGC
    TAA