MEGAResFrom MEG, the Microbial Ecology Group

ARNA

The arnA gene encodes an enzyme with dehydrogenase and transformylase domain that participate in Lipid A modification and resistance to polymyxin B.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/15939024

Other Groups in Polymyxin B resistance regulator

Sequences

Download Sequences

>>MEG_1122|Drugs|Cationic_antimicrobial_peptides|Polymyxin_B_resistance_regulator|ARNA
ATGACCTCGAAAGCCGTCGTCTTCGCCTACCACGACATCGGTTGCACCGGTATCGAAGCCCTGCTCAATGCCGGCTACGA
GATCGCCGCCGTCTTCACCCATGCCGACGACCCACGGGAAAACACCTTCTACGCCTCGGTCGCACGCCTCTGCGCCGAGC
GCGGCATTCCGCTGCACGCGCCCGAGGACGTGAACCATCCGCTGTGGCTGGAGCGTATCCGCCAACTGCGCCCGGACTTC
CTGTTCTCCTTCTACTACCGCCGCCTGCTCGGCGCCGAGCTGCTCGCCTGCGCCGCACGCGGCGCCTACAACCTGCACGG
TTCGCTGCTGCCGCGCTACCGCGGACGCGCCCCGGCGAACTGGGTGCTGGTCAACGGCGAAACGCAGACCGGGGTGACCC
TGCATCGCATGATCGAGCGCGCCGACGCCGGGCCGATCCTCGCCCAGCAGGCCGTCGCCATCGACCCCGAGGACACCGCC
CTGAGCCTGCACGGCAAGCTGCGCAAGGCCGCCGGCGCCCTGCTGCGCGACAGCCTGCCGCTGCTCGCCCTCGGCGTGCT
GCCGGAAGTCGAGCAGGACGAGAGCCAGGCCAGCCACTTCGGCCGGCGCACCCCGGCGGACGGCCTGCTCGACTGGCACA
GGCCGGCACGGCAGTTGTACGACCTGGTGCGCGCGGTGACCCAGCCCTACCCTGGCGCCTTCTGCCAGGTCGGCGAACAG
AAGCTGATCGTCTGGAGCGCCGAGGTGGTCGCCGGCAACCACGGCCGCGAGCCGGGCAGCGTACTGTCCTGCGACCCGCT
GCGGATCGCCTGCGGCGAGGACTCGCTGGTGCTGCGCTTCGGCCAGCGCGGCGAGCGCGGCCTGTACCTGGCCGGCACGC
AACTGGCCACCGAGCTGGGCCTGGTCGAGGGCGCGCGCCTGCGTGGCGCGGCATGCAGTCCGCAGCGCCGCACGCGGGTG
CTGATCCTCGGGGTCAACGGCTTCATCGGCAACCACCTGTCCGAACGCCTGCTGCGCGACGGTCGCTACGAGGTCCACGG
CATGGACATCGGCTCCGACGCCATCGAACGGCTCAAGGCCGACCCGCATTTCCACTTCGTCGAAGGCGACATCGGCATCC
ATTCGGAGTGGCTCGAATACCATGTGAAGAAATGCGACGTGATCCTGCCGCTGGTGGCCATCGCCACGCCCATCGAGTAC
ACGCGCAACCCGCTGCGGGTGTTCGAACTGGACTTCGAGGAAAACCTGCGGATCGTCCGCTACTGCGTGAAATACGGCAA
ACGCGTGGTGTTCCCTTCCACCTCCGAGGTCTACGGCATGTGCCAGGACCCGGACTTCGACGAAGACCGCTCGAACCTGG
TGGTCGGGCCGATCAACAAGCAGCGCTGGATCTACTCGGTGTCCAAGCAGTTGCTCGACCGGGTGATCTGGGCCTACGGC
CAGCAGGGCCTGCGCTTCACCCTGTTCCGTCCGTTCAACTGGATGGGCCCGCGCCTGGACCGCCTGGATTCGGCGCGGAT
CGGCAGCTCGCGGGCGATCACCCAGCTCATCCTGCACCTGGTCGAAGGCACGCCGATCCGCCTGGTCGACGGCGGCGCGC
AGAAGCGCTGCTTCACCGACGTCGACGACGGCATCGAGGCCCTCGCGCGGATCATCGACAACCGCGACGGCCGCTGCGAC
GGGCAGATCGTCAACATCGGCAACCCGGACAACGAGGCGAGCATCCGCCAGCTCGGCGAGGAACTGCTGCGCCAGTTCGA
GGCCCACCCGCTGCGCGCGCAGTTCCCGCCCTTCGCCGGCTTCCGCGAGGTGGAGAGCCGCAGCTTCTACGGCGACGGCT
ACCAGGACGTGGCCCACCGCAAGCCGAGCATCGACAACGCCCGGCGCCTGCTCGACTGGCAGCCCACCATCGAACTGCGC
GAGACCATCGGCAAGACCCTCGACTTCTTCCTCCACGAAGCGCTCCGCGAGCGCGAGGCACAGGCGTGA