MEGAResFrom MEG, the Microbial Ecology Group

PMRC

The pmrC gene encodes a component of the bacterial inner membrane required for Lipid A modification and resistance to polymyxin B.

References

Other Groups in Lipid A modification

Sequences

Download Sequences

>CARD|phgb|AP009048|4338624-4340268|ARO:3003576|PmrC|Cationic_antimicrobial_peptides|Lipid_A_modification|PMRC
TCATTCACTCACTCTCCTGCAAGTTTGCAGAATATCATCCGCAGCCTGGTAATACTTCGTCTCAACGCCAGTTAATCCCA
ATAGCGTGGAGAATAAATTGTCTTGTGAATAGTGTTGCGTTTGCGCCTGTTTTTGCAGGCAGTTCTGGTCAACCTGATAC
CGTTTTTGATAATCCTCCGACAGCCACAGCAGCATCGGCACCTGTTTTTGGCTATCCGGGGCGATGGCATAAGGCAGACC
GTGCAGATAGATGCCATTTTCACCTAACGATTCACCGTGGTCAGAAAGATAAACCAGGCTGGTGGTAAATTTATCCTGAT
GTTCTTTCAGCAGATTAATCGCTTTATCAACAATATAGTCGACGTAAACCAGCGTGTTGTCGTAAGTGTTCACCAGTTGC
TCTTTGGTACAGGTCTGGATCTCATTGGTGTCGCAGGTTGGGGTAAATTTCCTGAACTGAGGCGGATAGCGGTTGTAATA
GGTCGGACCGTGGCTGCCGATGGTGTGTAAGACAATCACGCCATCACCTTGCAGGTTATTGATGTACTCTTCAAGCCCGT
GGAACAGCACTTCGTCATAGCATTCGCCGTTGATGCACTGATCAGGTAGATTCAGCGCGGTGACGTTCTGGTGAGGCACG
CGGTCGCAGGCACCTTTACAGCCGCCATCGTTGTCATTCCACAGCACGTTGATGCCCGCTCGCTGAATGATATCCAGCAC
GCCTTCCTGGTGCTGTGCCAGCTCTTCTTTGTAGTGCTCACGCGGCATATCCGAGAACATGCACGGTACTGAAACTGCCG
TTGCCGTGCCGCAAGATGCGGTATTAGGGAAATAGACCACGTTATCTTTCGCCAGCCGCGGGTTAGTTTCACGCGGGTAG
CCGTTGAGGGAGAAGTTCTCCGCCCGCGAGGTTTCGCCGACAATCAGGATGGTCAAATTTTTACGTTTTTCGTTCTGCAT
TAACGGGTTGCGGTGCGCGTCTTCACCAATTCGCACCAGCGGCAGATTTGCCAGTCGCTGATGGGAGTACCATGACCAGC
TGGCAACAATGCTGTTAGAGGGGCTTAAGGATTTCACCAGCTCTTTGTTATTGCGGAACAACGAGGCGTAGTCTTTATAA
AACAGTGCGGCGACCAGCAAAATCAGTAGTACAGAAACCAGAATATTGGCTCCACGGAAAAGAACACTGCGCAGACGCGA
GGTGGCAGGTTTGATTTTTATCCAGCAGGCAATCAGCGCAGCAAGCACGCCGCTGAATCCCAGCGTTAATAACATTTGCG
GTGTCATCAGCGCATAACTTTCTGCCGGAGTGGTATCAATAATATTGGCAATCATCGAGCGGTCGATGACGATGCCGTAA
GTCATTATGAAATATTGTGCAGCCGCGCCAACCAGAATAAACAGGCAGGCCAGTGGTCGATTAAGCCATAAGAAAGAGCT
TAGTGTCAGGACAATATTAATCACGCTGAAAGCGACGACCGGCATCGACAAGAAAACCAGTACGTTATGCAGCGAATCCA
GCGGCAGCGCCTGCAACACCTGTTTAAAAAAGGCAATATTCAGGCAGATAGAGATATAAAAAGCGGCCAACAATAGCCAG
GCGAGTAAATTCAAAGAGGGTCTTTTTAGTAGGCGCTTCAACATC

>CARD|phgb|U00096|2098446-2099613|ARO:3003577|PmrE|Cationic_antimicrobial_peptides|Lipid_A_modification|PMRC
TTAGTCGCTGCCAAAGAGATCGCGGGTGTATACCTTATCTGCCACATCCTTAAGCTCTTCTGCCATTCGGTTAGAGATAA
TGACGTCGGCTTGTTGTTTGAAGGTGGCGAGATCACGTTCCAGGCGAGAGTTGAAGAATGAGTCTTCTTTCATCACTGGC
TCGTAGATGATCACTTCAACACCTTTCGCCTTGATACGTTTCATAATCCCCTGAATAGAAGACGCACGGAAGTTATCTGA
ACCGCTCTTCATAATCAGACGATAAATACCCACCACTTGCGGCTTGCGTGACAAAATGGCATCGGCAATAAAATCTTTAC
GCGTGCGGTTAGCATCGACAATTGCCGAGATCAGGTTATTCGGCACAGACTGGTAGTTCGCCAGTAACTGCTTGGTATCT
TTCGGCAGACAATAACCACCATAACCAAACGACGGATTGTTGTAATGGTTGCCAATACGTGGGTCGAGACAAACGCCTTC
GATTATTTGACGGGAATTCAGACCTAAACTTTCTGCATAGCTATCCAGTTCGTTAAAGTACGCCACGCGCATCGCCAGGT
AGGTGTTTGCAAAAAGTTTAATCGCTTCTGCTTCAGTGGAGTCGGTAAACAGCATCGGGATATTTTGCTTAATCGCGCCT
TCCTGTAACAGAGCAGCGAAACGTTCTGCGCGTTCTGAACGCTCACCGATGACAATACGTGAAGGATGGAGATTATCGTA
AAGGGCTTTACCCTCACGGAGAAATTCCGGGGAGAATATAATATTTTCAGTGCGATATTTCTTATGCATCGCTGCGGTAA
AACCAACGGGAACCGTTGATTTGATGACCATAACCGCATAAGGATTTATCTCAACTACGTCTTTAATTACTGATTCTACA
CTGGATGTATTGAAATAATTAGTTTTAGGATCATAGTCGGTTGGAGTGGCGATGATGACATAATCAGCATCCCGGTAGGC
TTCATTTTTATCTAATGTGGCATTAAAGTGTATTTTATCTGATTGCAAAAACTGCTGAATTTCCTTATCAACAATAGGAG
ATATCCGATCATTCAGCATAGCAACGCGTGACGGTAAAATATCTAATGCCACAACCTCATGATTTTGTGCGATTAGAAGC
CCGTTTGACAAGCCTACATAGCCAGTACCGGAAATGGTGATTTTCATT