MEGAResFrom MEG, the Microbial Ecology Group

MPRF

The mprF gene encodes a bacterial defensin resistance protein. Mutations in this gene have been linked to daptomycin resistance and multi-drug resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3205971/

Sequences

Download Sequences

>>MEG_4053|Drugs|Cationic_antimicrobial_peptides|Defensin-resistant_mprF|MPRF
TTGTTGAAAAAGCTAATTGAAAAAGTCAAATCACTGACTTCTGTGATTAAAATTGTATTTTTTATATCTGTTTTAGTGCT
TATTATTGTTGAAATGATTCATTTGAAACGAACTATTTCTGTTGAGCAACTAAAGAGTGTTTTTGGGCAATTATCTCCAA
TGAATCTTTTCTTAATTATCCTTGTGGGGGTTATCGCTGTCTTACCGACAACCGGATATGACTTTGTACTGAATGGACTT
TTACGTACAGATAAAAGCAAAAGGTATATTTTACAGACTAGTTGGTGTATCAACACTTTTAATAACTTGTCAGGATTCGG
TGGCTTAATCGATATTGGGTTGCGCATGGCTTTTTATGGTAAAAAAGGTCAAGAGAAGAGTGACCTAAGAGAAGTGACTC
GTTTTTTACCCTATCTTATTTCTGGTCTGTCATTTATTAGTGTGATTGCCTTAATCATGAGCCATATTTTTCATGCCAAA
GCTAGTGTTGATTACTATTATTTGGTATTAATTGGTGCTAGTATGTATTTTCCTGTTATTTATTGGATTTCTGGTCATAA
AGGAAGCCATTATTTCGGAGATATGCCATCTAGTACTCGTATAAAATTAGGTGTTGTTTCTTTTTTTGAATGGGGATGTG
CGGCCGCAGCATTTATAATTATCGGTTATTTAATGGGCATTCATCTACCAGTTTATAAAATTTTACCACTATTTTGTATT
GGTTGTGCCGTCGGGATTGTATCCCTTATTCCCGGTGGATTAGGAAGTTTTGAATTAGTTCTATTTACAGGGTTTGCTGC
CGAGGGACTACCTAAAGAAACTGTGGTTGCATGGTTATTACTTTATCGTTTAGCCTACTATATTATTCCATTCTTTGCAG
GTATCTATTTCTTTATCCATTATTTAGGTAGTCAAATAAATCAACGTTATGAAAATGTCCCGAAAGAGTTAGTATCAACT
GTTCTACAAACCATGGTGAGCCATTTGATGCGTATTTTAGGTGCATTCTTAATATTTTCAACAGCATTTTTTGAAAATAT
TACTTATATTATGTGGTTGCAGAAGCTAGGCTTGGACCCATTACAAGAACAAATGTTATGGCAGTTTCCAGGTTTATTGC
TGGGGGTTTGTTTTATTCTCTTAGCTAGAACTATTGATCAAAAAGTGAAAAATGCTTTTCCAATTGCTATTATCTGGATT
ACTTTGACATTGTTTTATCTTAATTTAGGTCATATTAGTTGGCGACTATCTTTCTGGTTTATTTTACTATTGTTAGGCTT
ATTAGTCATTAAGCCAACTCTCTATAAAAAACAATTTATTTATAGCTGGGAAGAGCGTATTAAGGATGGAATCATTATCG
TTAGTTTAATGGGAGTTCTATTTTATATTGCAGGACTACTATTCCCTATCAGGGCTCATATTACAGGTGGTAGTATTGAA
CGCCTGCATTATATCATAGCATGGGAGCCGATAGCATTGGCTACGTTGATTCTTACTCTCGTTTATTTATGTTTGGTTAA
GATTTTACAAGGAAAATCTTGTCAGATTGGTGATGTGTTCAATGTGGATCGTTATAAAAAACTACTTCAAGCTTACGGTG
GTTCTTCGGATAGCGGTTTAGCCTTTTTAAATGATAAAAGGCTCTACTGGTACCAAAAAAATGGAGAAGATTGCGTTGCG
TTCCAATTTGTAATTGTCAATAATAAATGTCTTATTATGGGGGAACCAGCCGGTGATGACACTTATATTCGTGAAGCTAT
TGAATCGTTTATTGATGATGCTGATAAGCTAGACTATGACCTTGTTTTTTACAGTATTGGACAGAAGTTGACACTACTTT
TACATGAGTATGGTTTTGACTTTATGAAAGTTGGTGAGGATGCTTTAGTTAATTTAGAAACGTTTACTCTTAAAGGGAAT
AAGTACAAACCTTTCAGAAATGCCCTAAATAGAGTTGAAAAGGATGGTTTCTATTTCGAAGTTGTACAATCGCCACATAG
TCAAGAGCTACTAAATAGTTTGGAAGAGATTTCTAATACTTGGTTAGAAGGACGTCCTGAAAAAGGTTTCTCACTAGGAT
ATTTTAATAAAGATTATTTCCAACAAGCCCCAATAGCTTTGGTAAAAAATGCTGAACACGAAGTTGTTGCTTTTGCTAAT
ATTATGCCAAACTATGAAAAGAGTATTATCTCTATTGATTTAATGCGTCACGATAAACAGAAAATTCCGAATGGCGTTAT
GGATTTCCTCTTTTTATCATTATTCTCTTATTATCAAGAGAAGGGATACCACTATTTTGATTTGGGGATGGCACCTTTAT
CAGGAGTTGGTCGCGTTGAAACAAGTTTTGCTAAAGAGAGAATGGCGTATCTTGTCTATCATTTCGGTAGTCATTTCTAC
TCATTTAATGGTTTACACAAGTATAAGAAGAAGTTTACACCATTGTGGTCGGAACGTTATATTTCTTGTTCTCGTTCGTC
CTGGTTAATTTGTGCTATTTGTGCCCTATTAATGGAAGATAGTAAAATTAAGATTGTTAAATAA

>>MEG_4054|Drugs|Cationic_antimicrobial_peptides|Defensin-resistant_mprF|MPRF
TTGCTCTGGTGGGACGACATTTCGATGAGCCTGATTGATGATGAAATACCTTCTTCGCAACCGCAAGTGTCAGGTAGGCA
TTTCGGCTGGTTGAAACAATATCAGCATTTTCTGTTTCCAATCGCAGGCATCGCCATTGCGTTATTGGCTATTTATGTTC
TGGAAAATCTTCTCAGGCACACCTCCCGCACCGAAACGCTTGCAGCCCTTCACAATATTTCATGGACGACGCTCGCACTG
GCCGTCTTTTTCACAGCATTAAGCTATGCCGCAGTGGCGCTTTATGATGTCGTGGCGGTGGACACCATAGCGCCCAACCA
GATACCGCGCCGCATCGCGGCGGTGGCGGGTGCTGCGGGCTATGCGATTTCCAACGCGCTCGGCTTCTCGCTCCTGACCG
GCGGGGCGCTGCGTTATCGCATTTATGCCGCAGAAGGCATAAGCCTGGCCGATATCGGCAAGATCGTCGGCACCTCATGG
TTCGCCATCTGGTTCGCCCTCATCATCATGGTGGGCGCAGCCCTGCTGATCGATCCGCAGGACGTGCCTTTTCTTTCCGC
CATCGATATACGGATTGATATTGTCGCAGGCATTCTCATCCTTGGCGGCATTGGCTGGCTGATCTACTGGCTTTCGCATG
GCGAACGCAATGTCAGCATCGGTTCGTTCAGCCTGCGCCTGCCCAATTCAAAAGGCGCGCTCACGCAGATTTTTGCGGGC
GTGGTGGATGTGGGCGCTGCCGCGGCCACGCTCTATGTGCTGTTGCCGGAAGGGGCTGTGCCAAGCTTCGCCGTCTTTGC
GCTCGTTTATGTCATCGCCATCGTGCTTGGCATTGCAAGCCACGCGCCAGGCGGCCTCGGCGCTTTTGAGGCAACAATCA
TCGCAGGGCTTGGCCTCGGTGGAAAACCCGATGCAATTGCGGGCCTGCTGGCCTATCGCCTCATTTACACGGTTCTTCCC
CTCGTGGTTGCCACCGCCGGAATCCTCATCTGGGAGGTCATGCGCCGCCGCCATATGCTCGACAAGCAGGCCCGATTCGC
CAAGCGGCTGGTGGAGCCGCTGGTTCCGGGGCTTTCAGCCAGCATCATCTTTCTCGGTGGCATCATCCTGCTTATCTCAG
GCGCCACGCCCGATATGCGCTATCGTGTGAAGTTGCTGTCCGACATCGTGCCGGAATTTCTTGTGGAGATGTCGCATCTG
GCGGCAAGCCTCGTCGGCGTTGCTCTTCTCATCGTCGCGCGCGGCCTTTCCAAACGGCTGGAGCGCGCCTGGGTGGCCGC
GATGGTGCTTCTTCTTTGCGGCGCGGTGTTTTCGATCGCAAAAGGACTGGACTGGGAAGAGGCAAGCATTTTGTGCCTTT
TTGCCCTTTCACTCTGGGGCTTTCGCGATTCCTTCTACCGTCGTCCGATTGCCGGCCCGTTTGAACTGAGCTGGAACTGG
ATCGCAACCGTTGGAACCACGGTTCTCGTGTCCACCTGGCTTGGTTTTTTCGTCTACCGCCATATCGAATATTCAAGCGA
TCTCTGGTGGGATTTCGCGTGGAACGGCAACGCCCCGCGTTTCCTGCGCGCCACCGTTCTGGTTTTCGCAGTCGTGGCGG
CAGTCGGCCTTCATTCGATCATCAACCGGCATGGCCAGCGCAGGCGCAAGGTTGATCATTCCATCCCCGATGCCGTGCCC
GCACTCGTCGCCCGGTGCCCGCATACAGATGCAGCCCTTGCCATGCTGGGCGACAAGCAATTTCTGCTGGCGCCCGACGA
CAGCGCGTTCATCATGTATGCGCAGTCGGGCGGCAGCCTGATCGCGCTTGGCGAGCCTATCGGCGATGCCGAAGCGGGCA
AGGAACTTGCCTGGTCTTTCCATTCGCTTGCCGACCGTCTGGCGCTGCGCACTGTCTTCTATGGTGTCGGCCCGCAAAGC
CTGCCGCTTTTCCTCGATATGGGCCTGATTGCGCTCAAGCTGGGTGAAGTCGCACGCGTTGACCTGACAGATTTTTCGCT
GGAAGGCCCGCGCCGCCAGCCCTTCCGTTATGCCGACCGCAAGGTGGACAAGGATGGGCTGACCTTCGAGATTATCCCTG
CTGCGGACGTGCCGCCGCTGATCCCGCGCCTGCGCGCAATTTCCGACGCTTGGCTCGACCATAAATCAGGCAGCGAAAAG
GGTTTTTCGCTTGGCTATTTCAACGATGAGTATTTAAAGCGTTTCGATATTGCCGTGCTGAAGAAAGACGGCGAAATCGT
TGCTTTCGCCAATATATGGCGCGGTGCCGACAAGTATGAGATCACGGTCGACCTGATGCGCTACATGCCCAATGTGCACA
AGCTCCTGATGGATGCGCTGTTCGCCAAGCTGCTGACCTTTTCCAAGCAAGAAGGCTACAAATGGTTCAACCTTGGCGCG
GCCCCGCTTTCCGGCCTTAGCGGCAGCAGGCTTGCCTCGCGCTGGAACCGTTTCGGCTCGTTCATCTATCGCCGTGGGGC
CGATCTTTATCACTTCGACGGGCTCAAAGCCTTCAAGGAAAAATTCGATCCCGTCTGGACCCCGCATTATATGGTTTGCC
CCGGCGGGCTTGAAACGCCGCGCGCCCTTCTTGATGCCACAACACTGATTAACGGCAGCCCTTTGGAGTTCATTCGCAAA
TGA

>>MEG_4055|Drugs|Cationic_antimicrobial_peptides|Defensin-resistant_mprF|MPRF
ATGAAAGAAAAATTAATGCAAGCCTATGCCTGGTTTCAAAAAAATAGTACCGTCGTAAAAATCGTTTTTATTACTTTTGT
GATGGCTTTTGTTATTTTTGAAATTATTAATATTGCGACGGGGATTGACTATCCGTCGCTAAAAGAAAATTTAACTTCTC
AAAGCCCGGAACAAATATTTATTATGTTTATCGTGGGCTTAATTGCTGTCACTCCAATGCTTTTGTATGATTATGTCATC
GTTAAGTTGTTACCTGGAAAGTTTTCGCCAAGTCATGTGATTGCCTCTGGTTGGATTACGAATACCTTTACTAATATTGG
CGGTTTTGGTGGCGTATTAGGTGCCAGTTTAAGAGCAAGTTTTTATGGGAAAAATGCATCTCATAAGGAAATTTTACTAG
CTATTTCTAAGATTGCTTTATTTTTAGTATCTGGTTTATCGATTTACTGTTTAGTATCATTAGCCACTTTACTCATTCCA
GGATTTGCAGATCATTTTGTTAATTACTGGCCATGGCTTCTTGCGGGTGGTCTTTACTTCCCGATTTTATTTACTATTAC
GAAATGGAAAAGTAAGTCACTCTTTGTTGATTTACCTATCAAAAGAGAATTAACGTTAATTATCGCTTCTCTTTTGGAGT
GGGGCTTCGCTTTTGGATGTTTCGCGATTATCGGTACATTGATGGGAGAACCAGTCGATATTTTCAAAGTGTTCCCGTTA
TTTGTTATTGCTTCGGTAATTGGGATTGCTTCGATGGTACCTGGTGGAGTAGGGACATTTGACGTCGTGATGATTCTTGG
ACTTAGCCAATTAGGTGTTTCTCAAGAATTAGCGCTCGCTTGGATGCTATTTTACCGAATTTTCTACTATATTATTCCTT
TTGTAGTGGGACTACTTTTCTTCGTCCAAAAAGCTGGTAAAAAAGTAAATGACTTTTTAGAAGGATTACCGTTATTATTC
TTACAAAAAGTGGCCCATCGCTTCTTAGTTATTTTTGTTTACGGCTCTGGGTTATTGTTAATTTTGTCTTCCGCCGTACC
AAACGCTATTTACCATGTGCCATTCTTATACAAAATTATGCCGTTTAATTTCTTATTCACTTCCCAAATTACCATTGTTG
CATTTGGCTTTTTACTACTGGGGCTTGCGAGAGGGATTGAATGTAAAACAAAGAAAGCGTATATTATTACAGTAATTGTT
CTAGGTTGCGCGATTTTCAACACACTTGCTCGCGTATTTTCGATGAAGCAGGCAATCTTTTTAGGAATTGTGCTGTTATG
TTTATTCTTAGCTCGAAACGAATTTTACCGAGAAAAACTGGTTTATACTTGGAGTAAAGTAATTATTGATAGCATTATTT
TCATCGTATGTCTGGCAGGTTACATTGTTATCGGTATTTACAACTCACCAAATATCAAACACTCCAAAGAAATCCCTGAC
TATTTACGCATTGCCTCAGAGCATTTATGGTTAGTCGGCTTCGTTGGCGTATTTATCGCCGTTGTTAGTTTAGTCATTAT
TTACATTTATTTATCCACAACAAAAGAAAAACTTGGCTCTCCATTTGAAGCAGTCAAAGTACGCGAACATTTAGCGAAAT
GGGGCGGAAATGAAGTCAGTCATACGATGTTCTTACGTGATAAACTGCTATTTTGGGCAGCAGAGGGGGAAGTACTTTTC
TCTTACCGAATCATTGCGGACAAAATGGTCATCATGGGCGAACCAACTGGGAACATGGACAAAATGGAAGCAGCGATTGA
AGAGGTAATGATGAACGCTGATAGATTTGGCTATCGACCTGTTTTCTATGAAGTCCGGGGCACGATGATTCCATATTTAC
ATGATCACGGATTTGACTTTATCAAGCTTGGCGAGGAAGGTTTTGTCGACGTCCAAAACTTTACAATGAGTGGTAAAAAG
AAAAAAGGTGAGCGAGCTCTCATGAATAAATTAGAACGAGAAGGTTATACTTTTGAAATAATAGAACCACCATTCAATCA
CGACACTTGGACAACTTTACGAGCAGTTTCTGATGAGTGGCTAGATGGTAGGGAAGAAAAAGGTTTCTCATTAGGATTCT
TCGATACGTATTATCTCGAACAAGCTCCGATTGCTATCGCTAAAAACGGAGAAGGTACTATCGTTGGATTTGCTTCGATG
ATGCCGTCATATACAGACGAAATGACTTCGATTGATTTAATGCGTTACTCCAAAGAAGCGCCATCAGGTATTATGGATTT
CCTTTTCATTAACCTATTCGAAAAAGCCAAAGAAGATGGCTTCCAAACATTTAATGCCGGTATGGCACCACTTGCCAATG
TTGGGGAAAGTAAATATGCTTTCCTAGGTGAACGATTAGCCGGACTTGTATACCGTTATAGTCAAGGTTTTTACGGTTTC
AAAGGATTACGTAATTTTAAATCCAAATATGTTACAGAATGGGAACAAAAATTTGTTGCCTTTAGAAAAAGAAGTTCCAT
TGCTTTCACCATGTTACAATTAATGATTCTTGTTGGTAAAAAACGACCACTTGCAAATAGCCAAGTAGTCCTTGATTTCC
CACTCGAAGAAGAAACAAAAAAACCAGATTCTGAGTAA

>>MEG_4056|Drugs|Cationic_antimicrobial_peptides|Defensin-resistant_mprF|MPRF
ATGTGGGATTCACTAAAAAAAAGTTATAGACATTTAAAAAATATTTTAGGATTTGTTACTGATAAAAGAAATTATGAAAA
TATAAAGAAGCTATTAAAAAATTACAAAATCTTAAGTGATATATCAAATATAATAGTATCAGTTTTGGTATTTCTAAGTG
GTATTCTTTTAATAATTTCAGGGATTTATCCTAGTATATTTTATAAGATAAAATTTTTAGATAATATATACAGTTTATCT
TTTTTAAGGTTTTCACATAGAGCTTCAATATTAATTGGATTAATGTTAATAATGACCTCTAAGGAAGTTTTCTTTAAGGT
AAAAAGAGCTTATTATGTTACATTAACATTGCTTATAGTAGGAGGAGCCTTTGCCTTTATAAAAGATTTAGATTACAAAG
AAGGAATTTTTATTTTAGGAGTAATAATACTTCTAATATTATCAAAAAAGAGTTTTTACAGAAAAAGTATTCCTATTAAG
GTTACTAAATTAAGTGGGATATTAATAGTTCTTTCAATTGTAATGATTATCTTTGCGAGTTTTATACATAAATTTAACAT
ACATTTTAGCAAGAACTATAAATACTATATAGACTTTTTCCATAGCACAAAGGGGTATTTAAGAATAGCATTATTCACAT
ATATATCCTTTATAATATTTGTGATAATATGGTATTTAACAATGCCTAAAATAGAAGATGACGAAAGGTATATGGATGCT
GATTTAGAAAAGGTATCAAAATTCTTTAAAGAAATAGATTATGGAACAATATTCTCCCATTTAGTTTATTTAAAGGATAA
AAAGGTCTTTTGGGCTAATGAAGGAGAGTCCTTAATAATGTATAGCAAGTACAAAGATAAGATAATAGTTTTAGGAGATC
CTATAGCTACTAAGGAAAACCTATATAGTTGTATAGAAGAGTTTCAAGCTTTTACAAATTTATATGGATATGATGTTGTC
TTTTATGAAATAGAAGAAAAAAACTTTTCTACCTATCATGATGCAGGGTATTATTTCTTTAAGTTAGGAGAAGAGGCAAG
GATAGATTTAGAAGAATTTAATTTGATTGGTTCTAAAAAGAGTGCCTTTAGAAACACCTTAAGAAGAGTTGAAAGGGAAG
GATATAATTTTAGCATTATAGAGCCTCCTTTTAATAATGAGGTAGTAAGTCAATTGAAGGAAATATCTGATAAATGGTTA
GGGGACAGAAAAGAAAAGGGATTTTCTTTAGGATGGTTTAGTGAGGATTATATACAAAGATCACCTATAGCTATTTTAAA
GAATGAAGAAGAAAATAAGATTATGGGCTTTGTAACAATAATGGATGCTAATGATGGAGGGGAGACAGTAGCAATAGATT
TAATGAGAATAGATAAAGATGCTCCAAATGCCTCTATGGATTACCTAATGCTTAATTTATTCTTAACCTTTAAAGAAAAA
GGATATAAGTATTTTAGCTTAGGAGAAGCACCATTATCTAATGTAGGATTTAACACTCATTCACATTTACAAGAAAAGCT
TGCAAGGTTAGTTTATAATAGTGGTAATATATTCTATAGTTTTGATGGACTAAGAAGATATAAGTCAAAGTTTTCTCCAA
TTTGGCAACCTAGATATTTAGCATATCCTAAGTTTATGTCCTTACCAGAGGTGTTTATTAACTTATGTTTATTAATAGCT
AATTCAAAGGAAAGAGTAGAGAAAAAATAA