Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

AIOB

The AIOB group of genes confer resistance to Arsenic resistance through the mechanism, Arsenite oxidase.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Arsenite oxidase

    Sequences

    Download Sequences

    >>MEG_713|Metals|Arsenic_resistance|Arsenite_oxidase|AIOB
    ATGGAACATCAAACTAGTCGCCGCAATTTTTTGAAGATTGCAGGGTCCTCTGCAGCAGTAGCAGGCGCAGGGCTTGTAAG
    CGGCAACGCCAACGCTGCTCCTGCAAAAGTAAATGTTGGAGCATCAACCCTACCTTATCCAATTACAGCCGTCGGCAAAG
    CGAAGGGATTGAAAGTAGATGCTCCGGTTAGTTTTAATTATCCAGATGCATCGTCACCTTGCGTAGCTATCAAAATGGGC
    CAGCCGACACCTGGTGGCGTTGGTCCTAATAACGATATCGTCGCGCACAGCATTTTGTGTACCCATATGGGATGTCCAGT
    GTCCTATGACGCTAGCGCCAAGACATTCAAGTGCCCATGCCACTTCTCCGTCTTTGATCCGGACAATCATGGGCAGATGG
    TGTGTGGGCAAGCTACCGAGAACCTTCCTCAGATTCAGTTGAGCTACAACGCTGCGAATGACACCTTCACGGCGATCGGC
    GTGACCGGCCTGATTTATGGCCGTCAATCCAACATTCTGTGA