Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_1139|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARRA ATGAAGAAAGAGAATCAAGTCAACTTGGGACGGCGCCAGCTGCTCAAGTCAACTGCGGCGGGAACGGTATTAACAGGTATTGGTGGAACCTTATCTTTTACACCTATTGTCGAGGGGATTGCCGCTGAATTACCCGCGCCTCTACGTAGAACGGGCGTGGGTGAATGGCTAGCCACGACTTGCCAAGGTTGTACCTCATGGTGCGCTAAACAGATTTATGTTATGGATGGCCGCGCATTAAAAGTGAGGGGTAATCCAAACTCCGGCGTACACGGTATGTCCAGTTGCCCTCGTCAGCACTTAAGCTTACAGCAGGTTTACGATCCTGATAGATTGCGCACGCCAATGATGCGAACTAATCCTAAAAAAGGCCGCGACCAAGATCCTAAATTTGTCCCTATTAGCTGGGATAAAGCGCTGGATATGTTAGCGGATAAAATCATTGCCTTACGTGTCGCTAACGAACCACATAAATATGCGCTTCTTCGTGGAAGATACTCGCATATCAATGATTTACTCTATAAAAAAATGACCAATCTGATTGGGTCTCCTAATAATATCTCCCATAGTTCAGTGTGCGCTGAAGCCCATAAAATGGGGCCTTACTATTTAGATGGTAACTGGGGATATAACCAATACGACGTTAAAAATGCTAAATTTATCCTGTCATTTGGTGCTGATCCCATTGCGAGTAACCGTCAAGTCTCGTTTTATTCTCAAACTTGGGGAGATTCACTCGATCACGCCAAAGTAGTTGTAGTTGACCCAAGACTTTCGGCTTCGGCGGCAAAAGCCCATAAATGGATCCCGATTGAACCTGGCCAAGACAGTGTTCTCGCACTCGCTATTGCCCATGTGGCCTTAGTTGAAGGTGTATGGCATAAGCCCTTTGTTGGAGATTTTATTGAGGGTAAAAACCTGTTTAAAGCAGGTAAAACCGTCAGTGTCGAGAGCTTTAAAGAAACCCATACCTACGGTTTAGTCGAATGGTGGAACCAGGCCCTTAAAGATTACACCCCTGAATGGGCAAGCAAAATTACCGGTATTGACCCTAAAACCATTATCGCCATTGCTAAAGATATGGGGGCGGCGGCGCCTGCGGTGCAAGTATGGACATCCCGAGGTGCAGTGATGCAGGCCCGTGGTACTTATACTTCAATTTCTTGTCATGCATTAAATGGCCTATTTGGTGGCATTGATAGCAAAGGGGGCTTATTCCCCGGTAATAAAACGCCACTGCTGAAAGAATATCCAGAGGCGAAAGCCTATATGGATGAGATTGCTGCTAAAGGGGTTAAAAAGGAAAAAATTGACCAACGTGGACGTCTTGAATTTCCTGCTCTGGCAAAAGGTAAATCCGGTGGCGGCGTGATCACGGCTAACGCAGCTAACGGTATCCGTAATCAAGACCCCTACGAAATTAAAGTGATGCTGGCCTACTTCAATAACTTTAACTTCTCCAACCCCGAAGGGCAGCGTTGGGATGAAGCCTTAAGTAAAGTCGACTTTATGGCGCACATTACCACCAACGTATCTGAATTCAGTTGGTTTGCGGATGTGTTACTTCCTTCTAGTCACCATATGTTTGAAAAATGGGGCGTGTTAGATTCTATCGGTAATGGTGTCGCCCAGATTTCAATTCAACAGCCTTCGATCAAGCGCTTGTGGGATACCCGTATTGATGAATCTGAAATCCCTTACATGTTAGCTAAAAAGCTGGCCGATAAAGGGTTTGATGCACCTTGGCGTTATATTAACGAACAAATTGTTGATCCAGAAACCGGTAAACCTGCGGCGGATGAAGCTGAATTTGCTAAATTAATGGTCAGATACCTCACCGCACCATTATGGAAAGAAGATGCGTCCAAATATGGCGACAAACTGAGCTCTTGGGATGAGTTCGTGCAAAAAGGGGTGTGGAATAGCTCTCCCTATAAGCTCGAAGCTCGCTGGGGTAAGTTTAAAACAGAAACCACTAAATTTGAGTTCTACAGCAAAACCTTAGAAAAAGCGCTGCAAAGTCATGCCGATAAGCACAAAGTTAGCATCGATGAGGTAATGAAAGCCTGTGACTACCAAGCCCGTGGCCACTTAGCCTTTATTCCCCATTATGAAGAGCCCTATCGTTTTGGTGATGAATCAGAATTCCCCTTGTTATTAGTGGATCAAAAGTCACGCCTTAATAAAGAAGGACGTACCGCAAATAGTCCTTGGTACTACGAGTTTAAAGATGTCGATCCAGGTGATGTGGCCAATGAAGATGTGGCGAAATTCAACCCGATAGACGGTAAGAAATTTGGCCTTAAAGACGGTGATGAAATTCGTATTACCAGTCCTGTGGGTATGCTGACCTGCAAAGCTAAGTTATGGGAAGGTGTTCGTCCTGGGACTGTGGCTAAGTGTTTTGGGCAAGGTCATTGGGCCTATGGCCGATACGCTAGTGCTAAATTTGGTGTCACTCCAAGGGGGGGCTCAAATAATGATTTGATTGCAGACAGATACGATCGCTTAAGTGGTGCGTCGGCATTTTATGGTCATATCCGTGTTCGTGTTGAGAAAGTGTGA >>MEG_1140|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARRA ATGAAGAAAGAGAATCAAGTCAACTTGGGACGGCGCCAGCTGCTCAAGTCAACTGCGGCGGGAACGGTATTAACAGGTATTGGTGGAACCTTATCTTTTACACCTATTGTCGAGGGGATTGCTGCTGAATTACCCGCGCCTCTACGTAGAACGGGCGTGGGTGAATGGCTAGCCACGACTTGCCAAGGTTGTACCTCATGGTGCGCTAAACAGATTTATGTTATGGATGGCCGCGCATTAAAAGTGAGGGGTAATCCAAACTCCGGCGTACACGGTATGTCCAGTTGCCCTCGTCAGCACTTAAGCTTACAGCAGGTTTACGATCCTGATAGATTGCGCACGCCAATGATGCGAACTAATCCTAAAAAAGGCCGCGACCAAGATCCTAAATTTGTCCCTATTAGCTGGGATAAAGCGCTGGATATGTTAGCGGATAAAATCATTGCCTTACGTGTCGCTAACGAACCACATAAATATGCGCTTCTTCGTGGAAGATACTCGCATATCAATGATTTACTCTATAAAAAAATGACCAATCTGATTGGGTCTCCTAATAATATCTCCCATAGTTCAGTGTGCGCTGAAGCCCATAAAATGGGGCCTTACTATTTAGATGGTAACTGGGGATATAACCAATACGACGTTAAAAATGCTAAATTTATCCTGTCATTTGGTGCTGATCCCATTGCGAGTAACCGTCAAGTCTCGTTTTATTCTCAAACTTGGGGAGATTCACTCGATCACGCCAAAGTAGTTGTAGTTGACCCAAGACTTTCGGCTTCGGCGGCAAAAGCCCATAAATGGATCCCGATTGAACCTGGCCAAGACAGTGTTCTCGCACTCGCTATTGCCCATGTGGCCTTAGTTGAAGGTGTATGGCATAAGCCCTTTGTTGGAGATTTTATTGAGGGTAAAAACCTGTTTAAAGCAGGTAAAACCGTCAGTGTCGAGAGCTTTAAAGAAACCCATACCTACGGTTTAGTCGAATGGTGGAACCAGGCCCTTAAAGATTACACCCCTGAATGGGCAAGCAAAATTACCGGTATTGACCCTAAAACCATTATCGCCATTGCTAAAGATATGGGGGCGGCGGCGCCTGCGGTGCAAGTATGGACATCCCGAGGTGCAGTGATGCAGGCCCGTGGTACTTATACTTCAATTTCTTGTCATGCATTAAATGGCCTATTTGGTGGCATTGATAGCAAAGGGGGCTTATTCCCCGGTAATAAAACGCCACTGCTGAAAGAATATCCAGAGGCGAAAGCCTATATGGATGAGATTGCTGCTAAAGGGGTTAAAAAGGAAAAAATTGACCAACGTGGACGTCTTGAATTTCCTGCTCTGGCAAAAGGTAAATCCGGTGGCGGCGTGATCACGGCTAACGCAGCTAACGGTATCCGTAATCAAGACCCCTACGAAATTAAAGTGATGCTGGCCTACTTCAATAACTTTAACTTCTCCAACCCCGAAGGGCAGCGTTGGGATGAAGCCTTAAGTAAAGTCGACTTTATGGCGCACATTACCACCAACGTATCTGAATTCAGTTGGTTTGCGGATGTGTTACTTCCTTCTAGTCACCATATGTTTGAAAAATGGGGCGTGTTAGATTCTATCGGTAATGGTGTCGCCCAGATTTCAATTCAACAGCCTTCGATCAAGCGCTTGTGGGATACCCGTATTGATGAATCTGAAATCCCTTACATGTTAGCTAAAAAGCTGGCCGATAAAGGGTTTGATGCACCTTGGCGTTATATTAACGAACAAATTGTTGATCCAGAAACCGGTAAACCTGCGGCGGATGAAGCTGAATTTGCTAAATTAATGGTCAGATACCTCACCGCACCATTATGGAAAGAAGATGCGTCCAAATATGGCGACAAACTGAGCTCTTGGGATGAGTTCGTGCAAAAAGGGGTGTGGAATAGCTCTCCCTATAAGCTCGAAGCTCGCTGGGGTAAGTTTAAAACAGAAACCACTAAATTTGAGTTCTACAGCAAAACCTTAGAAAAAGCGCTGCAAAGTCATGCCGATAAGCACAAAGTTAGCATCGATGAGGTAATGAAAGCCTGTGACTACCAAGCCCGTGGCCACTTAGCCTTTATTCCCCATTATGAAGAGCCCTATCGTTTTGGTGATGAATCAGAATTCCCCTTGTTATTAGTGGATCAAAAGTCACGCCTTAATAAAGAAGGACGTACCGCAAATAGTCCTTGGTACTACGAGTTTAAAGATGTCGATCCAGGTGATGTGGCCAATGAAGATGTGGCGAAATTCAACCCGATAGACGGTAAGAAATTTGGCCTTAAAGACGGTGATGAAATTCGTATTACCAGTCCTGTGGGTATGCTGACCTGCAAAGCTAAGTTATGGGAAGGTGTTCGTCCTGGGACTGTGGCTAAGTGTTTTGGGCAAGGTCATTGGGCCTATGGCCGATACGCTAGTGCTAAATTTGGTGTCACTCCAAGGGGGGGCTCAAATAATGATTTGATTGCAGACAGATACGATCGCTTAAGTGGTGCGTCGGCATTTTATGGTCATATCCGTGTTCGTGTTGAGAAAGTGTGA >>MEG_1141|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARRB ATGAGATTAGGAATGGTGATTGACCTACAAAAATGTGTAGGGTGTGGCGGCTGTAGCTTAGCCTGTAAAACAGAAAACAACACGAACGACGGTATTCACTGGTCGCATCATATTGCGACCACTGAGGGTACGTTCCCTGACGTTAAATACACATATATACCGACCCTGTGTAACCATTGTGATGATGCACCATGTGTTAAAGTGTGTCCTACAGGAGCGATGCACAAAGATAAACGCGGTTTAACGCTGCAAAACAATGATGAATGCATTGGTTGCAAGAAGTGTATGAATGCTTGCCCATACGGCGTGATTAGTTTTAATGCGGCAACACCGCACCGTCGTTGGCAGGATGACTCAGAGGTGGTCGCGAACGGAACTGTATCTCCACTTATGCTACTAAAGCGTACAGGGGCTACGGCAACACCTAATGAAAACCCAGAGCGGGGTGATACCTATCCGATGATACGGCCAAAGCGTACTACAGAGAAATGTACTTTCTGTGATCATAGGCTTGATAAGGGGTTGAATCCTGCCTGTGTTGACGCTTGTCCATCTGAAGCACGGGTAATTGGTGATTTAGATGATCCGCAGAGCAAGGTATCCCAGTTGATTAAATTGCATAAACCTATGCAGTTGAAACCTGAAGCGGGAACGGGACCAAGGGTATTTTATATTCGCAGTTTTGGTGTTAAAACCGCTTATTAA >>MEG_1145|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSB ATGTTACTGGCAGGGAGTATATTTGTACTGACACTGATCCTGGCTATCTGGCAACCCCGGGGGCTCAGTATTGGCTGGAGCGCCAGCATTTGTGCTGCGCTGGCCCTGGTATCCGGTGTTATTCATGTGGGTGATATTCCGGTTGTCTGGAATATCGTCTGGAACGCAACCGCGACCTTTATCGCGGTGATTATCATCAGCCTGCTGCTCGATGAGTCGGGTTTTTTCGAATGGGCTGCGCTGCATGTTTCGCGTTGGGGGAACGGGCGTGGTCGTCTGCTGTTTACCTGGATTGTCCTGTTAGGCGCAGCAGTAGCGGCGCTCTTTGCTAACGACGGTGCTGCGCTTATCCTGACCCCCATCGTCATCGCCATGCTGCTTGCGCTGGGGTTCAGCAAACGGACAACGCTGGCCTTTGTCATGGCCGCCGGGTTTATTGCCGATACTGCCAGCCTGCCGCTTATCGTATCGAACCTGGTAAACATCGTCTCTGCTGACTTCTTCCGGCTTGGCTTCACGGAATACGCTTCCGTCATGCTTCCCGTTGATATTGCTGCCATCGCCGCCACTCTGGGCATGCTGCATCTGTTTTTCCGCCGGGATATACCTGCAACGTACGACGTCTCTCTTCTGAAAATGCCTGCCAGTGCGATTAAAGATCCCGCAACCTTCAGAGCAGGCTGGATTGTTCTGGTTCTGTTGCTTGTCGGATTCTTTGTGCTTGAACCACTTGGTATCCCCGTCAGCGCTATTGCGGCCGTCGGCACTGTGGTGCTGTTCGCTGTCGCGAAAAAAGGCCACGCCATCAATACCGGAAAAGTACTGCGTGGTGCGCCGTGGCAGATCGTTGTTTTCTCACTGGGGATGTACCTGGTGGTCTATGGCCTGCGCAATGCGGGATTAACGGAATATCTTTCCGGGGTTCTGAATATGCTGGCGGATAAGGGGCTGCTGGCGGCAACGTTTGGGACTGGTTTCCTGACCGCATTCCTGTCATCGGTCATGAACAATATGCCAACCGTTCTTGTTGGAGCACTGTCGATTGACGGAAGCACGGCGTCTGGCGTCATCAAGGAAGCAATGATCTACGCCAACGTGATTGGTTGCGATTTAGGCCCCAAAATCACGCCGATAGGCAGTCTGGCGACCCTGTTGTGGCTGCACGTCCTGTCGCAGAAAAACATGACCATCAGCTGGGGATATTACTTCCGCACGGGTATCATCATGACCCTGCCTGTGTTGTTTGTCACTCTCGCCGCGCTGGCACTGCGGCTCTCTGTCACTTTGTAA >>MEG_1146|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSB ATGAAACGTTTATCTTTTTTAGACCGTTATTTAACCATCTGGATTTTCCTTGCGATGGCATTGGGGATAGGATTAGGTTTTATATTTCCGAGTTTTGTTGGTGGATTAAACAAATTACAAGTAGGAACTACATCTATCCCTTTAGCTATTGGATTAGTATTAATGATGTATCCACCACTAGCAAAGGTTCGATATGAAGAAATTGGACGGGTATTTAAAGATATTAAAGTGTTAATTTTATCTTTAGTGCAAAACTGGATCATCGGACCGACTCTCATGTTTATTTTGGCTATCATCTTTTTGCCAGATAAACCGGAGTATATGATTGGGCTTATTATGATTGGATTAGCTCGCTGTATTGCGATGGTTATTGTTTGGAATGACTTATCAAAAGGTGATACGGAATACGCGGCAGGATTAGTTGCTTTCAACTCAATTTTCCAAATGCTTTTTTCCTCAGTTTATGCTTACATTTTTGTAACAGTTATCCCGCAATGGTTAGGGATGGAAGGAGCAGTAGTGAATATTACGATGGCAGAAGTCGCAAAATCAGTATTCATTTACCTTGGAGTTCCTTTTATTGCAGGAATGGTGACACGTTATATTTTTGTAAAAGTGAAGGGCAAAGAATGGTATGAAAAAGTGTTCATTCCTAAGATTAGTCCAATTACGTTAATTGCTTTGCTATTTACAATTATCGTCATGTTTTCCTTAAAAGGTGATGTAATTGTTAGCTTGCCGTTAGATGTTGTCCGAGTTGCGATTCCATTATTGATTTACTTTGTTTTAATGTTCTTTGTTTCCTTCTTTTTAGGGAAGAAAATCGGGGCAAACTATGCTGTAACTACTACTTTAGCTTTTACAGCAGGAAGCAATAACTTTGAATTAGCGATTGCTGTAGCTGTTGGTGTATTTGGAATTCATTCGGGTGCAGCATTTGCCGCCGTAATTGGTCCGCTTGTAGAAGTGCCAGTCATGATAGCACTTGTTAAGGTTGCTTTATGGTTTCAACGAAAATACTTTGGAAGTCACTCGATGTAG >>MEG_1147|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSB ATGAAACGTTTATCTTTTTTAGACCGTTATTTAACCATCTGGATTTTTCTTGCGATGGCATTGGGGATAGGATTAGGTTTTATATTTCCGAGTTTTGTTGGTGGATTAAACAAATTACAAGTAGGAACTACATCTATCCCTTTAGCTATTGGATTAGTATTAATGATGTATCCACCACTAGCAAAGGTTCGATATGAAGAAATTGGACGGGTATTTAAAGATATTAAAGTGTTAATTTTATCTTTAGTGCAAAACTGGATCATCGGACCGACTCTCATGTTTATTTTGGCTATCATCTTTTTGCCAGATAAACCGGAGTATATGATTGGGCTTATTATGATTGGATTAGCTCGCTGTATTGCGATGGTTATTGTTTGGAATGACTTATCAAAAGGTGATACGGAATACGCGGCAGGATTAGTTGCTTTCAACTCAATTTTCCAAATGCTTTTTTTCTCAGTTTATGCTTACATTTTTGTAACAGTTATTCCGCAATGGTTAGGGATGGAAGGAGCAGTAGTGAATATTACGATGGCAGAAGTCGCAAAATCAGTATTCATTTACCTTGGAGTTCCTTTTATTGCAGGAATGGTGACACGTTATATTTTTGTAAAAGTGAAGGGCAAAGAATGGTATGAAAAAGTGTTCATTCCTAAGATTAGTCCAATTACGTTAATTGCTTTGCTATTTACAATTATCGTCATGTTTTCCTTAAAAGGTGATGTAATTGTTAGCTTGCCGTTAGATGTTGTCCGAGTTGCGATTCCATTATTGATTTACTTTGTTTTAATGTTCTTTGTTTCCTTCTTTTTAGGGAAGAAAATCGGGGCAAACTATGCTGTAACTACTACTTTAGCTTTTACAGCAGGAAGCAATAACTTTGAATTAGCGATTGCTGTAGCTGTTGGTGTATTTGGAATTCATTCGGGTGCAGCATTTGCCGCCGTAATTGGTCCGCTTGTAGAAGTGCCAGTCATGATAGCACTTGTTAAGGTTGCTTTATGGTTTCAACGAAAATACTTTGGAAGTCACTCGATGTAG >>MEG_1154|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC ATGGATAAGAAAACAATTTATTTTATATGTACAGGAAACTCTTGTCGTAGCCAAATGGCTGAAGGTTGGGGAAAGGAAATATTGGGTGAAGGTTGGAATGTCTATTCTGCTGGTATTGAAACACATGGTGTTAATCCTAAAGCAATAGAAGCTATGAAAGAAGTAGATATTGATATATCAAACCATACGTCAGACTTGATTGATAATGATATTTTAAAACAATCAGATTTGGTCGTAACGTTATGTAGTGATGCAGACAATAATTGTCCTATTTTACCACCAAACGTTAAAAAAGAGCATTGGGGTTTTGATGATCCAGCAGGTAAAGAATGGTCAGAATTCCAACGTGTTAGAGACGAGATTAAATTAGCTATAGAAAAGTTTAAATTGAGATAA >>MEG_1155|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC ATGGATAAGAAAACAATTTATTTTATATGCACAGGAAACTCTTGTCGTAGCCAAATGGCTGAAGGTTGGGGAAGGGAAATATTGGGTGAAGATTGGAATGTCTATTCTGCCGGTATTGAAACACATGGTGTTAATCCTAAAGCAATAGAAGCTATGAAAGAAGTAGATATTGATATATCAAACCATACGTCAGACTTGATTGATAATCATATTTTAAAACAATCAGATTTGGTCGTAACGTTATGTAGTGATGCAGACGATAATTGTCCTATTTTACCACCAAACGTTAAAAAAGAGCATTGGGGTTTAGAGGATCCAGCAGGTAAAGAATGGTCAGAATTTCAACGTGTTAGAGACGAGATTAAATTAGCTATAGAAAATTTTAAATTGAGATAA >>MEG_1156|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC ATGACTAAAAAAACAATTTATTTTATATGTACAGGCAACTCATGTCGAAGTCAAATGGCTGAAGGTTGGGCTAAACAAATCTTAGCGGATGATTGGAATGTATATTCTGCTGGTATCGAAACACACGGTGTTAATCCCAAAGCGATAGAAGCTATGAAAGAAGTAGGCATTGATATATCAAATCATACATCAAATTTAATCGATAATAATATTATTAAAAATTCAAATTTAGTTGTTACATTATGTAGTGATGCAGACGTAAATTGCCCTTCTTTACCAACAAATGTTAAGAAAGAACATTGGGGATTTGATGATCCTGCAGGCAAGCCTTGGTCAGAGTTCCAACGTGTAAGAGATGAAATTAAAATCGCAATTGAAAATTTCAAATCACGATGA >>MEG_1157|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC ATGACTAAAAAAACAATTTATTTTATATGTACAGGCAACTCATGTCGAAGTCAAATGGCTGAAGGTTGGGCTAAACAAATCTTAGCGGAAGATTGGAATGTATATTCTGCTGGTATCGAAACACACGGTGTTAATCCCAAAGCGATAGAAGCTATGAAAGAAGTAGGCATTGATATATCAAATCATACATCAGATTTAATCGATAATAATATTATTAAAAATTCAAATTTAGTTGTTACATTATGTAGTGATGCAGACGTAAATTGCCCTTCTTTACCAACAAATGTTAAAAAGGAACATTGGGGATTTGATGATCCTGCAGGCAAACCATGGTCAGAGTTCCAACGTGTGAGAGATGAAATTAAAATCGCAATTGAAAATTTCAAATCATGA >>MEG_1158|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC ATGACTAAAAAAACAATTTATTTTATATGTACAGGCAACTCATGTCGAAGTCAAATGGCTGAAGGTTGGGCTAAACAAATCTTAGCGAAAGATTGGGATGTATATTCTGCGGGTATCGAAACACACGGTGTTAATCCCAAAGCGATAGAAGCTATGAAAGAAGTAGGCATTGATATATCAAATCATACATCAGATTTAATCGATAATAATATTATTAAAAATTCAAATTTAGTTGTTACATTATGTAGTGATGCAGACGTAAATTGCCCTACTTTACCAACAAATGTTAAGAAGGAACATTGGGGATTTGATGATCCTGCAGGCAAACCATGGTCAGAGTTCCAACGTGTGAGAGATGAAATTAAAGTCGCAATTGAAAATTTTAAATCACGATGA >>MEG_1159|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC ATGGAGAATAAAATCATTTACTTTTTATGTACAGGGAACTCTTGCCGGAGCCAAATGGCTGAAGGATGGGCTAAACAATATTTAGGTGATGAGTGGAAAGTGTATAGCGCGGGGATAGAAGCACATGGATTAAATCCGAATGCTGTTAAAGCGATGAAGGAAGTTGGTATAGATATCTCTAATCAAACGTCAGATATAATCGATTCTGATATTCTGAACAATGCTGATTTAGTTGTTACGCTTTGTGGAGATGCTGCTGATAAATGCCCGATGACGCCTCCACATGTAAAACGTGAGCATTGGGGTTTTGATGATCCGGCAAGAGCACAAGGGACAGAAGAAGAAAAATGGGCGTTTTTCCAAAGAGTTCGTGATGAAATAGGGAATAGGTTGAAGGAATTTGCTGAAACAGGGAAATAA >>MEG_1160|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSC GTGAAAAAGGTAATGTTCGTTTGCAAACGTAATTCCTGTCGCTCCCAAATGGCAGAGGGCTTTGCCAAAACTTTAGGGGCCGGCAAAATTGCTGTTACCAGTTGTGGACTGGAATCTTCCCGGGTCCATCCCACCGCCATTGCCATGATGGAAGAAGTAGGCATAGACATCAGCGGCCAGACCTCCGACCCCATCGAAAACTTTAACGCCGACGATTACGACGTGGTAATTTCCCTTTGTGGCTGTGGGGTTAATCTGCCGCCGGAATGGGTAACCCAGGAAATTTTTGAAGACTGGCAACTGGAAGATCCCGATGGTCAATCATTGGAAGTTTTTCGCACCGTGCGGGGCCAGGTTAAGGAACGGGTGGAAAACCTGATCGCCAAAATTAGCTGA >>MEG_1165|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSD ATGAAAACGTTAATGGTATTTGACCCGGCGATGTGTTGCAGCACCGGCGTCTGCGGTACAGATGTTGATCAGGCTCTGGTCGATTTTTCTACAGATGTGCAATGGCTCAAACAATGCGGTGTACAAATTGAGCGTTTCAATCTTGCGCAACAACCGATGAGCTTTGTACAGAACGAGAAGGTCAAAGCGTTTATTGAAGCTTCCGGGGCAGAAGGTCTGCCATTGTTGTTACTGGATGGCGAAACAGTGATGGCCGGGCGTTACCCGAAACGCGCTGAGCTGGCTCGCTGGTTTGGCATTCCACTGGATAAAGTGGGATTAGCGCCTTCAGGTTGCTGTGGTGGTAATACTTCTTGTTGTTAA >>MEG_1167|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSH ATGGATCAGTTTCCAGCCCTGAATACTGAGTGTTTCGACAGGCAGATCGCTGAGCGGCTACAACATCCGGCACCACCACGTATCCTGATTCTGTATGGGTCAGTACGTGAACGTTCATACAGCCGTTTTGCCGCCGAAGAAGCTGGCCGACTGCTGACAGCCATGGGGGCTGAGGTCAAAACGTTTAACCCGTCCGGTTTACCTCTGCCTGATGATGCACCAGAAACTCACCCTAAAGTGACGGAGCTGCGCGAACTGGTGAGATGGTGTGACGGCATGGTCTGGAGTTCCCCGGAGCGTCACGGGGCGATGAGTGCGATAATGAAGGCTCAGATTGACTGGATCCCTTTGTCAGAAGGCGCAGTTCGTCCTTCCCAGGGAAAAACGCTGGCGGTCATGCAGGTCTGTGGCGGTTCTCAGTCTTTCAATGCTGTGAATCAGATGCGTATTCTGGGACGCTGGATGCGCATGTTCACCATCCCGAATCAGTCCTCCGTGGCGAAAGCCTGGCAGGAATTTGATGAAAACGGGCGCATGAAACCATCTTCCTGGTATGACCGCATCGTGGATGTGGTAGAAGAGCTGTTCAAAATCACTCTGCTGCTGAAAGGTCATACGGAGTACCTTGCCGATCGCTACAGTGAACGCAAGGAAAGTCATCAGGATTTGTCAGCGCGCGTCAATCAGGCCAAAATTTAG >>MEG_1169|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSM ATGCCCACTGACATGCAAGACGTGAAGGACATCGTCCGCGAGAAATACGCCAGCGCCGCGCTGAAGGTCGCCACCGGCGGCGCCTCGTGCTGCGGATCGTCGGCACTGCCCGGCGCCAGCCCGATCACCAGCAATCTCTACGACGCGGCGCAGGAACAGGGCCTGCCCGCCGAGGCGATGCTGGCATCGCTCGGCTGCGGCAACCCGACCGCACTGGCGCAGCTGTCGCCGGGCGAGACCGTGCTCGATCTCGGCTCCGGCGGCGGCATCGACGTGCTGCTGTCGGCGCGCCGGGTCGGCCCGACCGGCAAAGCCTACGGCCTCGACATGACCGACGAGATGCTGGCGCTGGCGCGCGACAACCAGCGCAAGGCCGGCCTCGACAACGTCGAATTCCTCAAGGGCGAGATCGAGGCGATCCCCCTGCCCGACCATTCGGTCGACGTGATCATCTCGAACTGCGTCATCAACCTGTCGGGCGACAAGGACCGGGTGCTGCGCGAGGCGTTCCGGGTGCTGAAGCCGGGCGGGCGGTTCGCGGTGTCGGACGTGGTGACCCGCGGCGAGATTCCGGAAGCGCTGCGCCGCGACGTGCTGCTGTGGGTCGGCTGTCTTGCCGGCGCACTCGACGAGGCCGACTACGTCGCCAAGTTGGCTGCCGCGGGCTTCGCGCAGATCTCGATCGAGCCGACCCGCGTGTACGACATCGAGGACGCCCGCGAATTCCTCACCGGTAAGGGCATCGACGTCGACGCCCTCGCCCCGCAAATGCAGGACAAATTCTTCAGCGGCTTCGTCCGTGCCACCAAGCCCGGCGCGGACGGCGAGGTGCCGGCGCGCTGCTGCGGGTGA >>MEG_1170|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSP ATGCAGTCTTTTTTAAATACTTTCAAAGAGTTTTTATATCTATTTACTGAGCTTTCTGTACTTTTTATAGCTATTTCTTTTTTAGTTTCTATTATCAATCAAAAATACGAAGGAATTTTTAAAAAACAACTTGCTGGTGATAAAATTTCAAGTTATTTTAAAGCTATATTTTTAGGTGCTTTAACGCCATTTTGTTCCTGTTCTACCATACCGCTTTTAAGAGCTTTTTTGGAAGCGAAAGTAAAACTTAGCGTAGCTTTAGCTTATCTTTTTACTTCACCTCTTATTAATCCTATCATTTTTTCCATGCTTTTTATAACTTTTGGTTTAAAGTTAAGTTTGACTTATGTGGTTTTTTTAGTATTTTTGATATTTATTGTTTCTTTTGTTTTTTCCAAATTTAAGGAAGAGAGTTTTTTAAAACATATCCCTAAAAATACAAAATCAAATATTTTTACCCAAACCACTCACAATCCTAGCAATTTTATTTTTAAACAAAAATCATGCTGTGCAAATACTCAAGATAAGCCTAAAAATATAACGATAAACTATAAAGAATTATTCAAAGAAAGTTTGAAAAATTATAAAAAATTATTACCCTATATCGTTGTGGCAGTTTTTATCGGTGCTTTTATTCATGGTTTCATTCCTCAAGAAATTTTACAAAAATACCTAAATGGGAATGAAATTTTAAGCATTGTATTAGCGGCTTTTTTAGGAATTTTCCTTTATTTAAGAGTAGAAACTATTATTCCTATAGGCTTAGCACTTTTGCGAATGGGAATTTCCCAAGGAGTGATTATGAGTTTTTTAATCGCTGGTGCTGGATGTTCTTTACCTGAGCTTATTTTACTCAAACAAATGTTTAAAATAAAATTTTTATTTTTATTTGTTATGATTATTTTAGGCGTGGCTATATCTTTTGGAATTTTTATTAATTTAATTTAA >>MEG_1178|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARST ATGTCGATTCAAGAGGTTGAGCTGATCATCATTGGATCCGGGCCCGCCGGCTATACGGCTGCGGTGTATGCGGCGCGGGCGGGCCTTGCCCCGGTCGTGCTGGCCGGTTCCGTCACCGCGGGCGGTGCGCTCATGACGACCACCGAGGTGGAGAACTTCCCCGGTTTCGTCGATGGTGTCCAGGGTCCGGAGTTGATGGAGTCGATGCGCGCGCAGGCCGAGCGCTTCGGCGCCCGCATCCTTCTCGACGACGCTGTCTCGGTCGACCTGGCAGGGCCGGTGAAGACGGTGCGCACCGGATCGGGCGACACCTACCTGGCGCGTGCGGTGATCCTCACCATGGGGTCGGCCTACCGCAAGATCGGACTGGCCGATGAAGAGCGTCTCACCGGTCACGGGGTCTCCTGGTGTGCGACCTGCGACGGCTTCTTCTTCCGCGACCAGGAGATCGTCGTGGTCGGCGGTGGCGATTCGGCGATGGAGGAAGCGCTGTTCCTCACCCGGTTCGCGTCGAAGGTCACCGTGGTGCACCGTCGCGACACGTTCCGCGCCTCACAGATCATGGCGCAGCGGGTGCTCGAGCACCCGAAGATCGACGTCGCCTGGAACAGCGAAGTAGCCGGCATCCTCGGGACGGACAAGGTCGAGGCGGTCACGCTGCGCGACACGGTCTCCGGAGTGGAACGCGAACTCTCCGTGACAGGGGTCTTCGTCGCCATCGGGCACGACCCGCGCTCCGAGCTCGTCGCAGGCTCCGTCGACACGGACGCTGACGGGTATGTGCGGGTCGCCCACCCGTCCACCCGCACCACCCTCGACGGCGTCTTCGCCGCCGGCGACCTGGTCGACCACACCTACCGGCAGGCCATCACCGCAGCCGGCACGGGTTGCGCGGCCGCCCAGGACGCCCAGCACTACCTCGCGGCCCTCACGGACACCGCGCCCGCATTCGACGCCCAGGAGGTCCTCGCATGA >>MEG_5813|Metals|Arsenic_resistance|Arsenic_resistance_protein|PSTA ATGGCTATGGTTGAAATGCAAACCACTGCGGCGCTGGCTGAATCTCGCCGCAAAATGCAGGCGCGTCGCCGCCTCAAAAACCGTATTGCGCTGACGCTCTCGATGGCGACGATGGCCTTCGGCCTGTTCTGGCTGATCTGGATTTTAATGTCCACCATCACTCGCGGTATCGACGGTATGTCGCTGGCGCTGTTCACTGAAATGACGCCGCCGCCCAATACGGAAGGTGGTGGTCTGGCGAACGCTCTGGCGGGTAGCGGGCTGTTAATTTTGTGGGCCACGGTATTCGGTACGCCGCTGGGCATTATGGCGGGGATTTATCTGGCGGAATATGGTCGTAAATCCTGGCTGGCAGAAGTGATTCGCTTCATTAACGACATTCTGCTCTCTGCGCCGTCGATTGTGGTTGGTCTGTTTGTTTACACCATTGTGGTGGCGCAGATGGAGCACTTCTCCGGCTGGGCGGGCGTGATTGCCCTGGCGTTGTTGCAGGTGCCGATTGTTATCCGCACCACCGAGAACATGCTGAAACTGGTGCCGTACAGCCTGCGTGAAGCGGCTTATGCGCTGGGTACACCGAAGTGGAAGATGATCTCTGCGATTACGCTGAAAGCGTCGGTGTCCGGGATTATGACCGGTATCCTGCTGGCGATTGCCCGTATTGCTGGTGAAACCGCGCCGCTGCTGTTTACCGCGCTCTCCAACCAGTTCTGGAGCACGGACATGATGCAGCCGATCGCCAACCTGCCGGTGACGATCTTTAAGTTTGCGATGAGCCCGTTTGCGGAATGGCAGCAATTGGCCTGGGCCGGGGTATTGATCATTACCCTGTGCGTACTGCTGCTGAACATTCTGGCGCGCGTTGTTTTTGCGAAGAATAAACACGGTTGA >>MEG_5814|Metals|Arsenic_resistance|Arsenic_resistance_protein|PSTB ATGAGTATGGTTGAAACTGCCCCGAGTAAAATTCAGGTTCGTAATTTGAACTTCTACTACGGCAAATTCCATGCCCTGAAAAACATCAACCTGGATATCGCTAAAAACCAGGTAACGGCGTTTATCGGGCCGTCCGGCTGCGGTAAATCGACGCTGCTGCGTACCTTCAACAAAATGTTTGAACTGTACCCGGAGCAGCGTGCGGAAGGTGAAATTCTGCTTGATGGCGACAACATCCTGACCAACTCTCAGGATATCGCACTGCTGCGTGCGAAAGTGGGCATGGTGTTCCAGAAACCGACGCCGTTTCCGATGTCCATCTACGACAACATCGCTTTTGGCGTTCGTCTGTTTGAGAAGCTCTCCCGTGCCGACATGGACGAGCGCGTGCAGTGGGCATTGACCAAAGCCGCATTGTGGAACGAAACCAAAGATAAATTGCACCAGAGCGGTTACTCTCTCTCTGGTGGTCAGCAACAGCGTCTGTGTATTGCGCGTGGTATCGCCATTCGCCCGGAAGTGCTGCTGCTCGACGAACCGTGTTCGGCGCTCGACCCTATCTCTACCGGGCGTATTGAAGAGCTGATCACCGAACTGAAGCAGGATTACACCGTGGTGATCGTCACCCACAACATGCAGCAGGCTGCGCGTTGTTCCGACCACACGGCGTTTATGTACCTGGGCGAATTGATTGAGTTCAGCAACACGGACGATCTGTTCACCAAGCCAGCGAAGAAACAAACAGAAGACTACATCACCGGTCGTTACGGTTGA >>MEG_5815|Metals|Arsenic_resistance|Arsenic_resistance_protein|PSTC ATGGCTGCAACCAAGCCTGCTTTTAACCCACCGGGTAAAAAGGGCGACATAATTTTCAGCGTGCTGGTAAAACTGGCGGCGCTGATTGTGCTATTGATGTTGGGTGGCATTATTGTCTCTCTGATCATCTCCTCCTGGCCGAGCATTCAGAAATTTGGTCTGGCTTTCCTATGGACCAAAGAGTGGGATGCACCGAACGATATCTACGGGGCGCTGGTGCCGATCTACGGTACGTTGGTGACTTCGTTTATCGCGCTGCTGATCGCCGTCCCGGTGAGTTTCGGTATCGCCCTGTTCCTGACTGAGCTTGCGCCTGGCTGGCTGAAACGCCCGCTGGGTATCGCCATTGAGCTGCTGGCAGCCATTCCAAGTATCGTTTACGGCATGTGGGGCCTGTTTATCTTTGCGCCGCTGTTCGCCGTTTACTTTCAGGAGCCGGTCGGCAATATCATGTCGAATATCCCGATTGTTGGCGCGCTGTTCTCTGGCCCCGCATTTGGTATCGGTATCCTCGCGGCAGGCGTGATCCTCGCCATCATGATTATTCCGTACATTGCGGCGGTAATGCGTGATGTGTTCGAACAAACCCCGGTGATGATGAAAGAGTCGGCCTACGGTATTGGCTGCACCACCTGGGAAGTTATCTGGCGTATCGTTCTTCCGTTCACCAAAAATGGTGTTATCGGCGGCATCATGCTGGGGCTGGGCCGCGCGCTCGGTGAAACCATGGCGGTGACCTTTATCATCGGTAACACCTACCAGCTCGACAGCGCCTCGCTGTATATGCCGGGCAACAGTATCACCTCTGCGCTGGCGAACGAATTTGCGGAAGCGGAATCCGGTCTGCACGTTGCCGCACTGATGGAACTGGGCCTGATCCTGTTTGTGATTACCTTCATCGTCCTCGCCGCATCGAAGTTTATGATTATGCGCCTGGCTAAGAATGAGGGGGCACGCTAA >>MEG_5816|Metals|Arsenic_resistance|Arsenic_resistance_protein|PSTS ATGAAAGTTATGCGTACCACCGTCGCAACTGTTGTCGCCGCGACCTTATCGATGAGTGCTTTCTCTGTGTTTGCAGAAGCAAGCCTGACAGGTGCAGGTGCAACCTTCCCTGCGCCGGTGTATGCCAAATGGGCTGACACTTACCAGAAAGAAACCGGTAATAAAGTTAACTACCAGGGTATCGGTTCTTCCGGTGGCGTAAAACAGATTATCGCTAATACCGTTGATTTTGGTGCCTCTGACGCGCCGCTGTCTGACGAAAAACTGGCTCAGGAAGGTCTGTTCCAGTTCCCGACCGTGATTGGCGGCGTGGTGCTGGCGGTTAACATTCCAGGGCTGAAGTCTGGCGAACTGGTGCTGGATGGTAAAACCCTCGGCGACATCTACCTGGGCAAAATCAAGAAGTGGGATGATGAAGCCATCGCCAAACTGAATCCGGGTCTGAAACTGCCTTCACAAAACATTGCTGTAGTACGCCGCGCAGATGGCTCCGGGACTTCCTTCGTCTTCACCAGCTACCTGGCGAAAGTGAACGAAGAGTGGAAAAACAACGTTGGTACTGGCTCTACCGTAAAATGGCCGATCGGTCTGGGCGGTAAAGGTAACGACGGTATCGCCGCGTTCGTTCAGCGTCTGCCGGGTGCAATTGGTTATGTTGAATATGCTTACGCGAAGCAGAACAACCTGGCGTACACCAAACTGATCTCCGCTGATGGTAAACCGGTTAGTCCGACCGAAGAAAACTTCGCTAATGCAGCAAAAGGTGCAGACTGGAGCAAAACCTTCGCTCAGGATCTGACCAACCAGAAAGGCGAAGATGCATGGCCTATTACCTCTACCACGTTCATTCTGATCCACAAAGATCAGAAGAAACCAGAACAAGGCACAGAAGTGCTGAAATTCTTCGACTGGGCGTACAAAACCGGGGCTAAACAGGCGAACGACCTGGATTACGCCAGCCTGCCGGATAGTGTAGTTGAACAGGTTCGCGCTGCGTGGAAGACCAATATTAAAGACAGTAGCGGTAAGCCGCTGTACTAA >>MEG_5817|Metals|Arsenic_resistance|Arsenic_resistance_protein|PSTS ATGAAAGTTATGCGTACCACCGTCGCAACTGTTGTCGCCGCGACCTTATCGATGAGTGCTTTCTCTGTGTTTGCAGAAGCAAGCCTGACAGGTGCAGGTGCAACCTTCCCTGCGCCGGTGTATGCCAAATGGGCTGACACTTACCAGAAAGAAACCGGTAATAAAGTTAACTACCAGGGTATCGGTTCTTCCGGTGGCGTAAAACAGATTATCGCTAATACCGTTGATTTTGGTGCCTCTGACGCGCCGCTGTCTGACGAAAAACTGGCTCAGGAAGGTCTGTTCCAGTTCCCGACCGTGATTGGCGGCGTGGTGCTGGCGGTTAACATTCCAGGGCTGAAGTCTGGCGAACTGGTGCTGGATGGTAAAACCCTCGGCGACATCTACCTGGGCAAAATCAAGAAGTGGGATGATGAAGCCATCGCCAAACTGAATCCGGGTCTGAAACTGCCTTCACAAAACATTGCTGTAGTACGCCGCGCAGATGGCTCCGGGACTTCCTTCGTCTTCACCAGCTACCTGGCGAAAGTGAACGAAGAGTGGAAAAACAACGTTGGTACTGGCTCTACCGTAAAATGGCCGATCGGTCTGGGCGGTAAAGGTAACGACGGTATCGCCGCGTTCGTTCAGCGTCTGCCGGGTGCAATTGGTTATGTTGAATATGCTTACGCGAAGCAGAACAACCTGGCGTACACCAAACTGATCTCCGCTGATGGTAAACCGGTTAGTCCGACCGAAGAAAACTTCGCTAATGCAGCAAAAGGTGCAGACTGGAGCAAAACCTTCGCTCAGGATCTGACCAACCAGAAAGGCGAAGATGCATGGCCTATTACCTCTACCACGTTCATTCTGATCCACAAAGATCAGAAGAAACCAGAACAAGSSACAGAAGTGCTGAAATTCTTCGACTGGGCGTACAAAACCGGGGCTAAACAGGCGAACGACCTGGATTACGCCAGCCTGCCGGATAGTGTAGTTGAACAGGTTCGCGCTGSSTGGAAGACCAATATTAAAGACAGTAGCGGTAAGCCGCTGTACTAA