MEGAResFrom MEG, the Microbial Ecology Group

ARSH

The ARSH group of genes confer resistance to Arsenic resistance through the mechanism, Arsenic resistance protein.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Arsenic resistance protein

    Sequences

    Download Sequences

    >>MEG_1167|Metals|Arsenic_resistance|Arsenic_resistance_protein|ARSH
    ATGGATCAGTTTCCAGCCCTGAATACTGAGTGTTTCGACAGGCAGATCGCTGAGCGGCTACAACATCCGGCACCACCACG
    TATCCTGATTCTGTATGGGTCAGTACGTGAACGTTCATACAGCCGTTTTGCCGCCGAAGAAGCTGGCCGACTGCTGACAG
    CCATGGGGGCTGAGGTCAAAACGTTTAACCCGTCCGGTTTACCTCTGCCTGATGATGCACCAGAAACTCACCCTAAAGTG
    ACGGAGCTGCGCGAACTGGTGAGATGGTGTGACGGCATGGTCTGGAGTTCCCCGGAGCGTCACGGGGCGATGAGTGCGAT
    AATGAAGGCTCAGATTGACTGGATCCCTTTGTCAGAAGGCGCAGTTCGTCCTTCCCAGGGAAAAACGCTGGCGGTCATGC
    AGGTCTGTGGCGGTTCTCAGTCTTTCAATGCTGTGAATCAGATGCGTATTCTGGGACGCTGGATGCGCATGTTCACCATC
    CCGAATCAGTCCTCCGTGGCGAAAGCCTGGCAGGAATTTGATGAAAACGGGCGCATGAAACCATCTTCCTGGTATGACCG
    CATCGTGGATGTGGTAGAAGAGCTGTTCAAAATCACTCTGCTGCTGAAAGGTCATACGGAGTACCTTGCCGATCGCTACA
    GTGAACGCAAGGAAAGTCATCAGGATTTGTCAGCGCGCGTCAATCAGGCCAAAATTTAG