Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

ACR3

The ACR3 group of genes confer resistance to Arsenic resistance through the mechanism, Arsenic resistance membrane transporter.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Sequences

    Download Sequences

    >>MEG_398|Metals|Arsenic_resistance|Arsenic_resistance_membrane_transporter|ACR3
    ATGTTAGGTTTTATCGATAGATTTCTCACGCTTTGGATATTTTTAGCTATTTTTTTGGGTTTAATTTTAGGTATCATTTT
    CCCCAATATCGCTTTATTTTGGAATTTATTTGAGTACAAGTCTGTAAATGTAGTATTGACTTTATGTCTTATTTTGATGA
    TGTATCCGCCTTTGGCTAAGGTTGATTATGCAAAGCTTTCAAAGGTATTTGATTCTAAAAAAGTTATCTTGCTTTCTATG
    ATTTTAAATTGGTTTATAGGCCCTTTGCTTATGTTTATCTTAGCTTTTATTTTCTTAAAAGACGAGCCTTTATATATGCA
    AGGAGTTATCATCATCGGCTTGGCAAGATGTATCGCAATGGTGGTGGTATGGAGCGATTTAGCAAAAGGTGATAGAGAAT
    ACACCAGTGCTTTAGTAGCGATGAATAGCATTTTTCAAATTTTATTTTTTTCCACTTTGGCTTATATTTATCTGGATTTT
    TTACCAAAATTACTAGGTCAAAGCACTTTAGCTACAAGTTTAGATATAGATTTTTCAGCTCTAAGTAAAAATGTTTTGAT
    TTATTTAGGAATTCCTTTTTTAATGGGCTTTATAACAAGAACCCTACTTTTAAAATACAAAAGCAAACGATGGTACGAAA
    ATACCTTTTTACCTAAAATCAGCCCTATAACTCTTATCACCCTGCTAGCAACTATTATCATTATGTGTTCTTACAAAGCA
    AATGAAGTATTTCACCTGCCTTTAGAAGCTTTAAAAATAGCCTTTGTTTTGACTTTGTATTTTATCTTCATGTTTTTTCT
    AACTTGGTTTATTTCTAAGAAAAATCATCTTTCTTATCCTAAAACTTGTTCTTTATGCTTTAGTGCTAGTGGAAATAACT
    TTGAATTAGCTATAATCATTTGTATTGCTACTTTTGGGCTTCACTCAGAACAAGCTTTTGCAAGCATTATAGGCCCCTTA
    GTAGAAGTTCCTGTACTTATCTTACTTGTAAAATGGGCATTAGGCAAAAGTTTAAATTCTAAAAAAATGAATCAAGCCTC
    ATGA