MEGAResFrom MEG, the Microbial Ecology Group

PVRR

The pvrR gene encodes a regulatory protein that has been implicated in the conversion from antibiotic-resistant to antibiotic-susceptible forms of Pseudomonas aeruginosa in studies of cystic fibrosis.

References

  • http://www.nature.com/nature/journal/v416/n6882/abs/416740a.html

Sequences

Download Sequences

>MEG_5831|Drugs|Aminoglycosides|Aminoglycoside_resistance_by_absence|PVRR|RequiresSNPConfirmation
ATGAGCTGGAAATCCTATCGGGTGCTGGTGGTCGAAGATCAGCCGTTTCAGCGCGAATACCTGCTCAACCTGTTTCGCGA
GCGCGGCGTGCAGTACCTGGTAGGTGCCGGCGACGGCGCGGAGGCGTTGCGCTGCCTGAAGCAGGACAGGTTCGACCTGA
TCCTCAGCGATCTGATGATGCCGGGCATGGATGGTATCCAAATGATCCTGCAACTGCCGTATCTCAAGCATCGTCCGAAG
CTGGCGCTGATGAGCTCCTCGTCGCAGCGGATGATGCTCAGTGCCAGCCGGGTCGCCCAGAGTCTCGGCTTGTCGGTAAT
CGACCTGTTGCCCAAGCCGACTCTGCCCAAGGCCATCGGCCAACTTCTGGAACACCTGGAAAGATGCCTCAGGCAGAAGC
TGGAGCCGGAAACCGACGAGACTCCGCATGGGCGCACGGCGTTGCTGGATGCCCTGCATAACGAGCAACTGGTGACCTGG
TTCCAGGCTAAGAAATCCCTCCACACCGGGCGCATAGTCGGCGCCGAGGCGTTGATACGCTGGAGCCACCCGCAGCATGG
CCTGTTGCTGCCCAGCTGTTTCATGAGTGATGTCGACGCTACCGGTCTGCACGAGGCGTTGCTCTGGCGCGTGCTCGAAC
AGACCCTGAACGCCCAGGAATCGTGGCGCAGGGCGGGTTACGAGATTCCGGTTTCGGTGAATCTGCCGCCGCACCTGCTC
GATAACCAGGAACTTCCGGATCGACTCTATGAGTACGTCGGCGCTCGCGGGGCTTGTACCAGCTCACTATGTTTCGAGTT
GACCGAGAGCAGTGTCACAACTCTGTCAAGTAACTACTATGCAGGTGCCTGTCGCTTGCGCATGAAAGGGTTCGGATTGG
CCCAGGACGACTTTGGCCAGGGTTACAGCTCGTTCTATAACCTGGTCACGACGCCTTTCACGGAGCTGAAGATCGACCGC
TCCCTAGTCCAGGGATGCGTAGAGGATAACGGCCTCAATGCAGCTGTCATCAGTTGTATTGAGTTGGGTCACCGCCTGAA
TCTCGACGTGGTGGCCGAAGGCGTGGAGACCTGCGAGGAACTGAATCTTCTTCGTCGTCTTGGCTGCGACCGGGCGCAGG
GTTTCCTGATTTCTAAGGCAGTGTCTGCTCGTGAGTTCGAGCGGCAGTTAAGGGAGGACGGCCCCAGCCTCCTTGTTTAA