MEGAResFrom MEG, the Microbial Ecology Group

SPD

Aminoglycoside O-nucleotidyltransferases transfer a nucleoside triphosphate to the aminoglycoside, which results in resistance by drug modification. The spd gene encodes a nucleotidyltransferase that specifically acts on spectinomycin.

References

Other Groups in Aminoglycoside O-nucleotidyltransferases

Sequences

Download Sequences

>CARD|phgb|KC895984|1081-1855|ARO:3002631|spd|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|SPD
ATGGAGGAACCAAATAAGCAAATTGATAATGTTTTAATAGAATTGAAACGATTGTTTTCAAAAGATTTATTAGGAGTCTA
TTTATATGGTTCTTATGTTAAAGGGGGTTTAAAAAAAGATAGTGATGTTGATTTTCTAGTGATAATAAATAGAGATATGA
CTAAAGAAGAAAAAAGAATATTAATTTCGAAAATTATGCCTATCTCTAAAGAAATTGGTGAAGATACAAGTTTAAAATAT
ATAGAATTAACTGTGCTTAATTATCATGAAAATGAAAATTGGTCTTATCCACCTATTGAAGAGTTTATCTATGGGGAATG
GCTTAGAGAAGATTATTTAAATTATTTTATTCCAGAAAAGAATAACAACATTGATTTAACAATATTATTATATCAAGCCA
AGCTTTCTTCAATATCAATTTATGGCGAAAATAATATTAATAACTTAATTCCTGATGTTCCATTTATTGATTTACAAAAA
GCTATAAAGGAAAGTTCTAAAGAATTGATAAAAGATTTTTATGGTGATGAAACAAATGTTATTTTAACCCTTTGTCGTAT
GATCGTAACTTATGAAACAGGTAAGTTTTATTCAAAAGATTTAGCTGGCAGTATGATAATAGAAAATTTATCAGAAAATT
TATCAATTGAAGAAAATAATTTAATAAGTTTAGCTATTTCTAGTTATAAAAATGGTAATAGCGTTGATTGGGAACTTTTT
CCTGTTAAGAGTGTCATTAAAAAACTTTATGCTTATTTGAATTATAAATTATGAT