MEGAResFrom MEG, the Microbial Ecology Group

ANT6

Aminoglycoside O-nucleotidyltransferases transfer a nucleoside triphosphate to the aminoglycoside, which results in resistance by drug modification. Ant(6) nucleotidyltransferases modify the 6 functional group.

References

Other Groups in Aminoglycoside O-nucleotidyltransferases

Sequences

Download Sequences

>AGly|str_2_FN435330|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGAGGACTGAAAAAGAAATTTTAAATTTAGTTTCTGAATTTGCTTATCAACGAAGCAATGTAAAAATTATTGCTCTCGA
GGGTTCAAGAACTAATGAAAATATAAAAAAAGATAAGTTTCAAGATTATGATTTTGCTTTTTTCGTATCAGATATTGAGT
ATTTCACACATGAAGAAAGTTGGTTAAGTTTATTTGGAGAATTATTGTTTATACAGAAACCAGAAGATATGGAATTATTC
CCACCTGATTTAGATTATGGTTACAGTTATATAATGTATTTTAAAGATGGCATAAAAATGGATATTACATTAATTAATTT
AAAAGATTTAAATCGTTATTTTAGTGATTCTGATGGTCTTGTAAAAATTTTAGTTGATAAAGATAATTTAGTAACTCAAG
AAATTGTTCCAGATGACTCAAATTATTGGTTAAAAAAACCAACAGAACGAGAATTTTATGATTGCTGTAATGAGTTTTGG
AGTGTCTCAACGTATGTAGCAAAGGGTGTTTTTAGAAGAGAAATATTATTTGCTTTAGATCATTTCAATAATATTTTACG
TCCTGAATTATTAAGAATGATTTCTTGGTATATTGGCTTTAATAGGGGTTTTGATTTTAGTTTAGGAAAGAATTATAAGT
TTATAAACAAATATTTAACTGATAAAGAATTCAATATGCTTTTAGCTACTTTTGAGATGAATGGATATAGAAAGACATAC
CAATCTTTTAAGCTTTGTTGTGAATTATTTAAATATTATTCAAATAAAGTAAGTTGTTTAGGAAATTATAACTATCCAAA
TTACGAAAAAAATATTGAGAATTTTATTCGTAATAATTATGAGAATTAA

>AGly|AadK-Pm|CP002869|4442322-4441435|888|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGAAACCGGTTGGAACGGAGGAATACTGCTTGAGAAGTGAACATGAAATGATGAGTACCATTATCAATTTCGCTAAAAA
TGATGATAGAATACGACTGGCAACTTTGGAAGGGTCACGTACAAACAAAAATATTCCCGTTGATACATTCCGGGATTATG
ACATCTCTTACTTTGTAACAGATATTGAATCTTTCAAAGAGACTGACCAATGGCTTGAATTTTTTGGGAATCGGCTTATG
ATGCAAAAACCCGAAGATATGGAGCTTTTTCCGTCAGAGCTAGGTAACTGGTTTTCATATATAATTCTTTTTGAGGATGG
TAATAAGTTAGACTTAACACTTATTCCAATTAACGAAGTGGGGGATTATTTTACCAAGAACGACGGTTTAGTTGAGGTCC
TGCTTGATAAGGATACTCTAATCAATAATGAAGTGATCGCAGACGATCGTCAATATTGGATTAAAAAGCCGACCGCAAGA
GCATTTGATGATTGTTGTAATGAGTTCTGGATGGTTTCAACGTACGTAGTAAAAGGACTAGCCAGAAAAGAAATACTCTT
TGCGATTGACCATTTAAACGAGATTGGAAGACCTAATCTATTAAGAATGATGGCTTGGCAAATCGGGTCTGAACACGGAT
ATACTTTTAGCGTAGGGAAGAACTATAAATTTATTAATCGTTACCTTCCTAATGAAGATTGGGAAAAGCTCCTATCAACC
TATTCTGAGAATGGGTATCAGGAAATGTGGCAGTCGTTATTAACTTGTTATGAGTTATTTAGAAAATACTCAAAAGCTGT
GTCAGAAAGTCTCGGCTATACGTATCCAGATTATGACGAAGCTATTACTAAGTATACGGAAAATATTTACTCCTCATTAG
TAATTTAG

>AGly|M26879|gene|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGCGAAGTGAGCAGGAAATGATGGACATTTTTTTGGACTTTGCTTTGAACGATGAGAGAATCCGATTGGTCACTTTGGA
AGGGTCACGTACAAACAGAAATATCCCTCCTGACAACTTCCAAGATTATGACATCTCGTATTTTGTAACTGATGTAGAAT
CTTTTAAAGAAAATGATCAGTGGCTCGAAATCTTTGGGAAGCGCATTATGATGCAAAAACCAGAAGATATGGAGCTTTTT
CCTCCCGAATTAGGTAATTGGTTTTCATACATTATTCTTTTTGAGGATGGCAACAAATTAGATCTAACCCTTATTCCAAT
TCGTGAAGCAGAAGATTATTTTGCTAATAACGATGGTTTGGTTAAGGTATTGCTTGATAAGGATTCGTTCATCAACTATA
AAGTGACCCCAAATGATCGCCAATACTGGATAAAAAGGCCGACTGCAAGGGAATTTGATGATTGCTGTAATGAGTTCTGG
ATGGTTTCGACTTACGTAGTAAAAGGACTAGCAAGAAATGAAATCCTTTTTGCCATTGACCATTTAAATGAAATTGTACG
TCCTAATTTATTGAGAATGATGGCCTGGCATATCGCATCTCAGAAAGGGTATTCATTTAGTATGGGGAAGAACTATAAAT
TTATGAAGCGGTACCTTTCAAATAAAGAATGGGAGGAACTCATGTCTACATATTCTGTGAATGGGTATCAGGAAATGTGG
AAGTCTTTATTTACTTGCTATGCATTATTTAGAAAGTATTCAAAAGCTGTATCAGAAGGTCTTGCATATAAGTATCCTGA
TTACGATGAAGGTATTACTAAGTATACGGAAGGTATTTATTGCTCAGTAAAGTGA

>AGly|str_3_AM932524|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
AGGACGTAAAATATTATTGAAATGATCTAAAGCAAATAATATTTCTCTTCTAAAAACACCCTTTGCTACATATGTTGAAA
CACTCCAAAATTCATTGCAACAATCATGAAATTCTCGTTCTGTTGGCTTTTTTAACCAATAATTTGAATCATCTGGAACA
ATTTCTTTAGTTACTAAATTATCCTTATCAACTAAAATTTTTACAAGACCATCAGAATCATTAAAATAACGATTTAAATC
TTTCAAATTAATTAGCGTAATGTCCATTTTTATACCATCTTTAAAATACATTATATAACTATATCCATAATCTAAATCAG
GAGGAAATAATTCCATATCTTCTGGTTTCTGTATAAACAATAATTCTCCAAATAGACTTAACCAGCTTTCTTCACTGGTA
AAATAATCAACATCTGATACGAAAAAAGTAAAATCATAATCTTGAAATTTATCTTTTTTTATATTTTTATTAGTTCTTGA
ACCCTCGAGAGTAATAATTTTTATATTACTTTGTTGATAAGCAAATTCAGAAACTAAACTTAGAATTTCATTTTCAGTTC
TCAT

>AGly|Ant6-Ib|FN594949|27482-28339|858|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGAAAATGAGAACAGAGAAACAAATATATGATACTATACTTAATTTTGCTAAAGCAGATGATAGAATTAGGGTGGTTAC
TTTAGAAGGTTCAAGAACAAATATTAATATTATACCAGATGATTTTCAAGATTATGATATTACTTTTTTTGTCACAGACA
TGCAGAGTTTTATTAATAGTGATGAGTGGCTTAATGTTTTTGGAGAGAGACTTATTATGCAAAAACCCGAGGATATGGAA
TTGTTTCCAAAAGAAGAAAAAGGGTATTCATATCTTATGTTATTTTGGGACGGAGTTAAAATAGATTTGACATTATTGCC
ATTAGAAGTTTTAGATGAATATTTTACTTGGGATAAATTAGTAAAATTATTATTAGATAAGGATAATCGTGTTACTAATA
TACCAGTACCTACAGATGAAGATTATTATATAGAACATCCGACAGCACGTTCTTTTGATGATTGCTGTAATGAATTTTGG
AATACTGTAACATATGTAGTGAAAGGATTATGTCGAAAGGAAATTTTATTTGCAATCGACCATTTAAATAATATTGTGCG
TATGGAATTACTGCGAATGATTTCATGGAAGGTTGGAATAGAGCAAGGTTATAGTTTTAGTCTAGGAAAAAACTATAAAT
TTTTAGAACGATATATTTCACCTGAATTATGGAAGAAAATTCTTGCTACATATAATATGGGGTCATATACAGAAATGTGG
AAATCTTTAGAATTATGTATGGGAATTTTTAGAATGGTATCAAAAGAAGTGGCACAATGTTTAAATTATTTATATCCAGA
TTATGATAAAAATATTAGTAATTATGTTATAAGACAAAAAGAAAAATATCAAAGATAA

>CARD|phgb|AL009126|2735681-2736536|ARO:3002627|aadK|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
TCACTTTACTGAGCAATAAATACCTTCCGTATACTTAGTAATACCTTCATCGTAATCAGGATACTTATATGCAAGACCTT
CTGATACAGCTTTTGAATACTTTCTAAATAATGCATAGCAAGTAAATAAAGACTTCCACATTTCCTGATACCCATTCACA
GAATATGTAGACATGAGTTCCTCCCATTCTTTATTTGAAAGGTACCGCTTCATAAATTTATAGTTCTTCCCCATACTAAA
TGAATACCCTTTCTGAGATGCGATATGCCAGGCCATCATTCTCAATAAATTAGGACGTACAATTTCATTTAAATGGTCAA
TGGCAAAAAGGATTTCATTTCTTGCTAGTCCTTTTACTACGTAAGTCGAAACCATCCAGAACTCATTACAGCAATCATCA
AATTCCCTTGCAGTCGGCCTTTTTATCCAGTATTGGCGATCATTTGGGGTCACTTTATAGTTGATGAACGAATCCTTATC
AAGCAATACCTTAACCAAACCATCGTTATTAGCAAAATAATCTTCTGCTTCACGAATTGGAATAAGGGTTAGATCTAATT
TGTTGCCATCCTCAAAAAGAATAATGTATGAAAACCAATTACCTAATTCGGGAGGAAAAAGCTCCATATCTTCTGGTTTT
TGCATCATAATGCGCTTCCCAAAGATTTCGAGCCACTGATCATTTTCTTTAAAAGATTCTACATCAGTTACAAAATACGA
GATGTCATAATCTTGGAAGTTGTCAGGAGGGATATTTCTGTTTGTACGTGACCCTTCCAAAGTGACCAATCGGATTCTCT
CATCGTTCAAAGCAAAGTCCAAAAAAATGTCCATCATTTCCTGCTCACTTCGCATT

>738|JX560992.1|JX560992|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGAGATCAGAAAAAGAAATGATGGATTTAGTACTTTCTTTAGCAGAACAGGATGAACGTATTCGAATTGTGACCCTTGA
GGGGTCACGCGCAAATATTAATATACCTAAAGATGAATTTCAGGATTATGATATTACATATTTTGTAAGTGATATAGAAC
CGTTTATATCTAATGATGACTGGCTTAATCAATTTGGGAATATAATAATGATGCAAAAGCCGGAGGATATGGAATTATTC
CCACCTGAAGAAAAGGGATTTTCCTATCTTATGCTATTTGATGATTACAATAAAATTGATCTTACCTTATTGCCCTTGGA
AGAGTTAGATAATTACCTAAAGGGCGATAAATTAATAAAGGTTCTAATTGATAAAGATTGTAGAATTAAAAGGGACATAG
TTCCGACTGATATAGATTATCATGTAAGAAAGCCAAGCGCAAGGGAGTATGATGATTGCTGCAATGAATTTTGGAATGTA
ACACCTTATGTTATTAAAGGATTGTGCCGCAAAGAGATACTGTTTGCAATCGATCATCTGAACCAGATTCTACGGTTTGA
ACTACTTAGGATGATGTCGTGGAAGGTTGGGATAAAGACAGAATTTTCATTAAGTGTTGGGAAAAATTATAAGTATATTA
ACAAATACATTGATGAAGATCTATGGAATAGATTATTATCTACATATCGCATGGATTCCTATGAAAATATTTGGAAGTCA
TTATTTATATGCCACCAATTGTTCAGGGAAGTGTCCAAAGAGGTAGCAGAACTACTGGGGTTTGATTATCCAGAGTATGG
TAAGAACATAACAAGATATACCGAGGACATGTATAAAAAATATGTTGAAAATGACTATTTTTAA

>AGly|AadE-Pp|HE577054|1299623-1300477|855|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
GTGAGAAGTGAACCAGAAATGATGAATATGCTTGTAAAGTTTGCTATGAACGATAAAAGAATACGATTGGTCACGATGGA
AGGATCACGTACAAACTTCAATGTTCCTCCTGATTCATTTCAAGATTATGATATTTCTTACTTTGTAACAGATATGGATT
CTTTCAAGGAAAGTGATCAATGGCTGAACGTGTTTGGGGATAGGCTTATGATGCAAAAACCCGAGGATATGGAGCTTTTT
CCATCAGAACTAGGTAACTGGTTTTCATATATCATTCTTTTTGAGGATGGAAACAAATTAGATCTGACACTGATCCCTAT
AAACGAGGTAGAGGATTATTTTACGAATAGCGATGGTTTAGTTGAGGTTCTGCTCGACAAGGATGTGCTGATCCAAGAGG
AAGTGATCGCAAACGATCATCAATATTGGATTAAAAAGCCCACTGCAAGGGAATTTGATGATTGCTGTAATGAATTTTGG
ATGGTTTCAACTTATATCGTAAAAGGATTGGCGAGAAAAGAAATCCTGTTTGCTATTGACCATTTGAACGAGATTGCACG
ACCTAATTTGTTGCGAATGATGGCTTGGAAGATTGGATCAGAGCAAGGGTACACCTTTAGTGTAGGAAAAAACTATAAAT
TTATAAATCAGTATCTTCCTAATGAAGATTGGAAAAGCCTACTATCGACTTACTCAGAGAACGGCTATCAAGAAATGTGG
CAGTCTTTACTTACTTGTTATTCATTGTTTAGAACATACGCTAAGGCTGTGGCAAGCAGTTTGAAATATGAGTATCCAGA
ATACGATGAAGCCATTACTAGGTACACTGTAAATATTTATAATTCATTGAATTGA

>AGly|Str|X92946|18908-18060|849|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGAGGACTGAAAAAGAAATTTTAAATTTAGTTTCTGAATTTGCTTATCAACGAAGCAATGTAAAAATTATTGCTCTCGA
GGGTTCAAGAACTAATGAAAATATAAAAAAAGATAAGTTTCAAGATTATGATTTTGCTTTTTTCGTATCAGATATTGAGT
GTTTCACACATGAAGAAAGTTGGTTAAGTTTATTTGGAGAATTATTGTTTATACAGAAACCAGAAGATATGGAATTATTC
CCACCTGATTTAGATTATGGTTACAGTTATATAATGTATTTTAAAGATGGCATAAAAATGGATATTACATTAATTAATTT
AAAAGATTTAAATCGTTATTTTAGTGATTCTGATGGTCTTGTAAAAATTTTAGTTGATAAAGATAATTTAGTAATTCAAG
AAATTGTTCCAGATGACTCAAATTATTGGTTAAAAAAACCAACAGAACGAGAATTTTATGATTGCTGTAATGAGTTTTGG
AGTGTCTCAACGTATGTAGCAAAGGGTGTTTTTAGAAGAGAAATATTATTTGCTTTAGATCATTTCAATAATATTTTACG
TCCTGAATTATTAAGAATGATTTCTTGGTATATTGGCTTTAATAGGGGTTTTGATTTTAGTTTAGGAAAGAATTATAAGT
TTATAAACAAATATTTAACTGATAAAGAATTCAATATGTTTTTAGCTACTTTTGAGATGAATGGATATAGAAAGACATAC
CAATCTTTTAAGCTTTGTTGTGAATTATTTAAATATTATTCAAATAAAGTAAGTTGTTTAGGAAATTATAACTATCCAAA
TTACGAAAAAAATATTGAGAATTTTATTCGTAATAATTATGAGAATTAA

>AGly|AY712687.1|gene1|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
GAGGGGTCACGCGCAAATATTAATATACCTAAAGATGAATTTCAGGATTATGATATTACATATTTTGTAAGTGATATAGA
ACCGTTTATATCTAATGATGACTGGCTTAATCAATTTGGGAATATAATAATGATGCAAAAGCCGGAGGATATGGAATTAT
TCCCACCTGAAGAAAAGGGATTTTCCTATCTTATGCTATTTGATGATTACAATAAAATTGATCTTACCTTATTGCCCTTG
GAAGAGTTAGATAATTACCTAAAGGGCGATAAATTAATAAAGGTTCTAATTGATAAAGATTGTAGAATTAAAAGGGACAT
AGTTCCGACTGATATAGATTATCATGTAAGAAAGCCAAGCGCAAGGGAGTATGATGATTGCTGCAATGAATTTTGGAATG
TAACACCTTATGTTATTAAAGGATTGTGCCGTAAGGAAATTTTATTTGCTATTGATCATTTTAATCAGATTGTTCGCCAT
GAGCTGCTGAGAATGATATCATGGAAGGTCGGCATCGAAACAGGCTTTAAATTAAGTGTAGGCAAGAACTATAAGTTTAT
TGAAAGGTATATATCCGAGGATTTGTGGGAGAAACTTTTGTCCACCTACCGGATGGATTCCTATGAAAACATATGGGAAG
CATTATTTCTATGCCATCAATTGTTCAGGGCGGTATCCGGTGAGGTGGCGGAAAGGCTTCATTATGCCTATCCGGAGTAT
GATAGGAATATAACAAAATATACCAGGGACATGTATAAAAAATACACTGGTAAAACCGGCTGCCTGGATAGCACATATGC
CGCTGATATAGAAGAGAGGCGGGAACAGTGA

>CARD|phgb|NC_023287|60996-61860|ARO:3002626|ANT6-Ia|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
TTAAAAATAGTCATTTTCAACATATTTTTTATACATGTCCTCGGTATATCTTGTTATGTTCTTACCATACTCTGGATAAT
CAAACCCCAGTAGTTCTGCTACCTCTTTGGACACTTCCCTGAACAATTGGTGGCATATAAATAATGACTTCCAAATATTT
TCATAGGAATCCATGCGATATGTAGATAATAATCTATTCCATAGATCTTCATCAATGTATTTGTTAATATACTTATAATT
TTTCCCAACACTTAATGAAAATTCTGTCTTTATCCCAACCTTCCACGACATCATCCTAAGTAGTTCAAACCGTAGAATCT
GGTTCAGATGATCGATTGCAAACAGTATCTCTTTGCGGCACAATCCTTTAATAACATAAGGTGTTACATTCCAAAATTCA
TTGCAGCAATCATCATACTCCCTTGCGCTTGGCTTTCTTACATGATAATCTATATCAGTCGGAACTATGTCCCTTTTAAT
TCTACAATCTTTATCAATTAGAACCTTTATTAATTTATCGCCCTTTAGGTAATTATCTAACTCTTCCAAGGGCAATAAGG
TAAGATCAATTTTATTGTAATCATCAAATAGCATAAGATAGGAAAATCCCTTTTCTTCAGGTGGGAATAATTCCATATCC
TCCGGCTTTTGCATCATTATTATATTCCCAAATTGATTAAGCCAGTCATCATTAGATATAAACGGTTCTATATCACTTAC
AAAATATGTAATATCATAATCCTGAAATTCATCTTTAGGTATATTAATATTTGCGCGTGACCCCTCAAGGGTCACAATTC
GAATACGTTCATCCTGTTCTGCTAAAGAAAGTACTAAATCCATCATTTCTTTTTCTGATCTCAT

>AGly|Ant6-Ia|AF330699|22-930|909|Aminoglycosides|Aminoglycoside_O-nucleotidyltransferases|ANT6
ATGAGATCAGAAAAAGAAATGATGGATTTAGTACTTTCTTTAGCAGAACAGGATGAACGTATTCGAATTGTGACCCTTGA
GGGGTCACGCGCAAATATTAATATACCTAAAGATGAATTTCAGGATTATGATATTACATATTTTGTAAGTGATATAGAAC
CGTTTATATCTAATGATGACTGGCTTAATCAATTTGGGAATATAATAATGATGCAAAAGCCGGAGGATATGGAATTATTC
CCACCTGAAGAAAAGGGATTTTCCTATCTTATGCTATTTGATGATTACAATAAAATTGATCTTACCTTATTGCCCTTGGA
AGAGTTAGATAATTACCTAAAGGGCGATAAATTAATAAAGGTTCTAATTGATAAAGATTGTAGAATTAAAAGGGACATAG
TTCCGACTGATATAGATTATCATGTAAGAAAGCCAAGCGCAAGGGAGTATGATGATTGCTGCAATGAATTTTGGAATGTA
ACACCTTATGTTATTAAAGGATTGTGCCGTAAGGAAATTTTATTTGCTATTGATCATTTTAATCAGATTGTTCGCCATGA
GCTGCTGAGAATGATATCATGGAAGGTCGGCATCGAAACAGGCTTTAAATTAAGTGTAGGCAAGAACTATAAGTTTATTG
AAAGGTATATATCCGAGGATTTGTGGGAGAAACTTTTGTCCACCTACCGGATGGATTCCTATGAAAACATATGGGAAGCA
TTATTTCTATGCCATCAATTGTTCAGGGCGGTATCCGGTGAGGTGGCGGAAAGGCTTCATTATGCCTATCCGGAGTATGA
TAGGAATATAACAAAATATACCAGGGACATGTATAAAAAATACACTGGTAAAACCGGCTGCCTGGATAGCACATATGCCG
CTGATATAGAAGAGAGGCGGGAACAGTGA