MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

GIDB

The gidB gene of the gid operon encodes a methyltransferase that has been shown to be involved in the methylation of the 16S rRNA component of the 30S bacterial ribosomal subunit. Deletion of this gene confers resistance to aminoglycoside antibiotics.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/22318332

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_3135|Drugs|Aminoglycosides|Aminoglycoside-resistant_gidB|GIDB|RequiresSNPConfirmation
ATGTCTCCGATCGAGCCCGCGGCGTCTGCGATCTTCGGACCGCGGCTTGGCCTTGCTCGGCGGTACGCCGAAGCGTTGGC
GGGACCCGGTGTGGAGCGGGGGCTGGTGGGACCCCGCGAAGTCGGTAGGCTATGGGACCGGCATCTACTGAACTGCGCCG
TGATCGGTGAGCTCCTCGAACGCGGTGACCGGGTCGTGGATATCGGTAGCGGAGCCGGGTTGCCGGGCGTGCCATTGGCG
ATAGCGCGGCCGGACCTCCAGGTAGTTCTCCTAGAACCGCTACTGCGCCGCACCGAGTTTCTTCGAGAGATGGTGACAGA
TCTGGGCGTGGCCGTTGAGATCGTGCGGGGGCGCGCCGAGGAGTCCTGGGTGCAGGACCAATTGGGCGGCAGCGACGCTG
CGGTGTCACGGGCGGTGGCCGCGTTGGACAAGTTGACGAAATGGAGCATGCCGTTGATACGGCCGAACGGGCGAATGCTC
GCCATCAAAGGCGAGCGGGCTCACGACGAAGTACGGGAGCACCGGCGTGTGATGATCGCATCGGGCGCGGTTGATGTCAG
GGTGGTGACATGTGGCGCGAACTATTTGCGTCCGCCCGCGACCGTGGTGTTCGCACGACGTGGAAAGCAGATCGCCCGAG
GGTCGGCACGGATGGCGAGTGGAGGGACGGCGTGA