MEGAResFrom MEG, the Microbial Ecology Group

GIDB

The gidB gene of the gid operon encodes a methyltransferase that has been shown to be involved in the methylation of the 16S rRNA component of the 30S bacterial ribosomal subunit. Deletion of this gene confers resistance to aminoglycoside antibiotics.

References

Sequences

Download Sequences

>CARD|pvgb|AL123456|4407527-4408202|ARO:3003470|Mycobacterium|Aminoglycosides|Aminoglycoside-resistant_gidB|GIDB|RequiresSNPConfirmation
TCACGCCGTCCCTCCACTCGCCATCCGTGCCGACCCTCGGGCGATCTGCTTTCCACGTCGTGCGAACACCACGGTCGCGG
GCGGACGCAAATAGTTCGCGCCACATGTCACCACCCTGACATCAACCGCGCCCGATGCGATCATCACACGCCGGTGCTCC
CGTACTTCGTCGTGAGCCCGCTCGCCTTTGATGGCGAGCATTCGCCCGTTCGGCCGTATCAACGGCATGCTCCATTTCGT
CAACTTGTCCAACGCGGCCACCGCCCGTGACACCGCAGCGTCGCTGCCGCCCAATTGGTCCTGCACCCAGGACTCCTCGG
CGCGCCCCCGCACGATCTCAACGGCCACGCCCAGATCTGTCACCATCTCTCGAAGAAACTCGGTGCGGCGCAGTAGCGGT
TCTAGGAGAACTACCTGGAGGTCCGGCCGCGCTATCGCCAATGGCACGCCCGGCAACCCGGCTCCGCTACCGATATCCAC
GACCCGGTCACCGCGTTCGAGGAGCTCACCGATCACGGCGCAGTTCAGTAGATGCCGGTCCCATAGCCTACCGACTTCGC
GGGGTCCCACCAGCCCCCGCTCCACACCGGGTCCCGCCAACGCTTCGGCGTACCGCCGAGCAAGGCCAAGCCGCGGTCCG
AAGATCGCAGACGCCGCGGGCTCGATCGGAGACATT