MEGAResFrom MEG, the Microbial Ecology Group

TLYA

Resistance to aminoglycoside antibiotics can be conferred via overexpression of the MexXY-OprM efflux pump. This has been described via loss-of-function mutations in the MexZ gene, which is a repressor of the mexXY operon, resulting in overexpression of the pump.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/24145539

Sequences

Download Sequences

>>MEG_7258|Drugs|Aminoglycosides|Aminoglycoside-resistant_arabinosyltransferase|TLYA|RequiresSNPConfirmation
GTGGCACGACGTGCCCGCGTTGACGCCGAGCTGGTCCGGCGGGGCCTGGCGCGATCACGTCAACAGGCCGCGGAGTTGAT
CGGCGCCGGCAAGGTGCGCATCGACGGGCTGCCGGCGGTCAAGCCGGCCACCGCCGTGTCCGACACCACCGCGCTGACCG
TGGTGACCGACAGTGAACGCGCCTGGGTATCGCGCGGAGCGCACAAACTAGTCGGTGCGCTGGAGGCGTTCGCGATCGCG
GTGGCGGGCCGGCGCTGTCTGGACGCGGGCGCATCGACCGGTGGGTTCACCGAAGTACTGCTGGACCGTGGTGCCGCCCA
CGTGGTGGCCGCCGATGTCGGATACGGCCAGCTGGCGTGGTCGCTGCGCAACGATCCTCGGGTGGTGGTCCTCGAGCGGA
CCAACGCACGTGGCCTCACACCGGAGGCGATCGGCGGTCGCGTCGACCTGGTAGTGGCCGACCTGTCGTTCATCTCGTTG
GCTACCGTGTTGCCCGCGCTGGTTGGATGCGCTTCGCGCGACGCCGATATCGTTCCACTGGTGAAGCCGCAGTTTGAGGT
GGGGAAAGGTCAGGTCGGCCCCGGTGGGGTGGTCCATGACCCGCAGTTGCGTGCGCGGTCGGTGCTCGCGGTCGCGCGGC
GGGCACAGGAGCTGGGCTGGCACAGCGTCGGCGTCAAGGCCAGCCCGCTGCCGGGCCCATCGGGCAATGTCGAGTACTTC
CTGTGGTTGCGCACGCAGACCGACCGGGCATTGTCGGCCAAGGGATTGGAGGATGCGGTGCACCGTGCGATTAGCGAGGG
CCCGTAG

>>MEG_7259|Drugs|Aminoglycosides|Aminoglycoside-resistant_arabinosyltransferase|TLYA|RequiresSNPConfirmation
ATGACACAGTGCGCGAGCAGACGCAAAAGCACCCCAAATCGGGCGATTTTGGGGGCTTTTGCGTCTGCTCGCGGGACGCG
CTGGGTGGCCACCATCGCCGGGCTGATTGGCTTTGTGTTGTCGGTGGCGACGCCGCTGCTGCCCGTCGTGCAGACCACCG
CGATGCTCGACTGGCCACAGCGGGGGCAACTGGGCAGCGTGACCGCCCCGCTGATCTCGCTGACGCCGGTCGACTTTACC
GCCACCGTGCCGTGCGACGTGGTGCGCGCCATGCCACCCGCGGGCGGGGTGGTGCTGGGCACCGCACCCAAGCAAGGCAA
GGACGCCAATTTGCAGGCGTTGTTCGTCGTCGTCAGCGCCCAGCGCGTGGACGTCACCGACCGCAACGTGGTGATCTTGT
CCGTGCCGCGCGAGCAGGTGACGTCCCCGCAGTGTCAACGCATCGAGGTCACCTCTACCCACGCCGGCACCTTCGCCAAC
TTCGTCGGGCTCAAGGACCCGTCGGGCGCGCCGCTGCGCAGCGGCTTCCCCGACCCCAACCTGCGCCCGCAGATTGTCGG
GGTGTTCACCGACCTGACCGGGCCCGCGCCGCCCGGGCTGGCGGTCTCGGCGACCATCGACACCCGGTTCTCCACCCGGC
CGACCACGCTGAAACTGCTGGCGATCATCGGGGCGATCGTGGCCACCGTCGTCGCACTGATCGCGTTGTGGCGCCTGGAC
CAGTTGGACGGGCGGGGCTCAATTGCCCAGCTCCTCCTCAGGCCGTTCCGGCCTGCATCGTCGCCGGGCGGCATGCGCCG
GCTGATTCCGGCAAGCTGGCGCACCTTCACCCTGACCGACGCCGTGGTGATATTCGGCTTCCTGCTCTGGCATGTCATCG
GCGCGAATTCGTCGGACGACGGCTACATCCTGGGCATGGCCCGAGTCGCCGACCACGCCGGCTACATGTCCAACTATTTC
CGCTGGTTCGGCAGCCCGGAGGATCCCTTCGGCTGGTATTACAACCTGCTGGCGCTGATGACCCATGTCAGCGACGCCAG
TCTGTGGATGCGCCTGCCAGACCTGGCCGCCGGGCTAGTGTGCTGGCTGCTGCTGTCGCGTGAGGTGCTGCCCCGCCTCG
GGCCGGCGGTGGAGGCCAGCAAACCCGCCTACTGGGCGGCGGCCATGGTCTTGCTGACCGCGTGGATGCCGTTCAACAAC
GGCCTGCGGCCGGAGGGCATCATCGCGCTCGGCTCGCTGGTCACCTATGTGCTGATCGAGCGGTCCATGCGGTACAGCCG
GCTCACACCGGCGGCGCTGGCCGTCGTTACCGCCGCATTCACACTGGGTGTGCAGCCCACCGGCCTGATCGCGGTGGCCG
CGCTGGTGGCCGGCGGCCGCCCGATGCTGCGGATCTTGGTGCGCCGTCATCGCCTGGTCGGCACGTTGCCGTTGGTGTCG
CCGATGCTGGCCGCCGGCACCGTCATCCTGACCGTGGTGTTCGCCGACCAGACCCTGTCAACGGTGTTGGAAGCCACCAG
GGTTCGCGCCAAAATCGGGCCGAGCCAGGCGTGGTATACCGAGAACCTGCGTTACTACTACCTCATCCTGCCCACCGTCG
ACGGTTCGCTGTCGCGGCGCTTCGGCTTTTTGATCACCGCGCTATGCCTGTTCACCGCGGTGTTCATCATGTTGCGGCGC
AAGCGAATTCCCAGCGTGGCCCGCGGACCGGCGTGGCGGCTGATGGGCGTCATCTTCGGCACCATGTTCTTCCTGATGTT
CACGCCCACCAAGTGGGTGCACCACTTCGGGCTGTTCGCCGCCGTAGGGGCGGCGATGGCCGCGCTGACGACGGTGTTGG
TATCCCCATCGGTGCTGCGCTGGTCGCGCAACCGGATGGCGTTCCTGGCGGCGTTATTCTTCCTGCTGGCGTTGTGTTGG
GCCACCACCAACGGCTGGTGGTATGTCTCCAGCTACGGTGTGCCGTTCAACAGCGCGATGCCGAAGATCGACGGGATCAC
AGTCAGCACAATCTTTTTCGCCCTGTTTGCGATCGCCGCCGGCTATGCGGCCTGGCTGCACTTCGCGCCCCGCGGCGCCG
GCGAAGGGCGGCTGATCCGCGCGCTGACGACAGCCCCGGTACCGATCGTGGCCGGTTTCATGGCGGCGGTGTTCGTCGCG
TCCATGGTGGCCGGGATCGTGCGACAGTACCCGACCTACTCCAACGGCTGGTCCAACGTGCGGGCGTTTGTCGGCGGCTG
CGGACTGGCCGACGACGTACTCGTCGAGCCTGATACCAATGCGGGTTTCATGAAGCCGCTGGACGGCGATTCGGGTTCTT
GGGGCCCCTTGGGCCCGCTGGGTGGAGTCAACCCGGTCGGCTTCACGCCCAACGGCGTACCGGAACACACGGTGGCCGAG
GCGATCGTGATGAAACCCAACCAGCCCGGCACCGACTACGACTGGGATGCGCCGACCAAGCTGACGAGTCCTGGCATCAA
TGGTTCTACGGTGCCGCTGCCCTATGGGCTCGATCCCGCCCGGGTACCGTTGGCAGGCACCTACACCACCGGCGCACAGC
AACAGAGCACACTCGTCTCGGCGTGGTATCTCCTGCCTAAGCCGGACGACGGGCATCCGCTGGTCGTGGTGACCGCCGCG
GGCAAGATCGCCGGCAACAGCGTGCTGCACGGGTACACCCCCGGGCAGACTGTGGTGCTCGAATACGCCATGCCGGGACC
CGGAGCGCTGGTACCCGCCGGGCGGATGGTGCCCGACGACCTATACGGAGAGCAGCCCAAGGCGTGGCGCAACCTGCGCT
TCGCCCGAGCAAAGATGCCCGCCGATGCCGTCGCGGTCCGGGTGGTGGCCGAGGATCTGTCGCTGACACCGGAGGACTGG
ATCGCGGTGACCCCACCGCGGGTACCGGACCTGCGCTCACTGCAGGAATATGTGGGCTCGACGCAGCCGGTGCTGCTGGA
CTGGGCGGTCGGTTTGGCCTTCCCGTGCCAGCAGCCGATGCTGCACGCCAATGGCATCGCCGAAATCCCGAAGTTCCGCA
TCACACCGGACTACTCGGCTAAGAAGCTGGACACCGACACGTGGGAAGACGGCACTAACGGCGGCCTGCTCGGGATCACC
GACCTGTTGCTGCGGGCCCACGTCATGGCCACCTACCTGTCCCGCGACTGGGCCCGCGATTGGGGTTCCCTGCGCAAGTT
CGACACCCTGGTCGATGCCCCTCCCGCCCAGCTCGAGTTGGGCACCGCGACCCGCAGCGGCCTGTGGTCACCGGGCAAGA
TCCGAATTGGTCCATAG