MEGAResFrom MEG, the Microbial Ecology Group

RPSL

The rpsL gene encodes the S12 component of the 30S ribosomal subunit. Mutations in the S12 protein, which is part of the 30S ribosomal subunit, or in homologous regions in the 16S rRNA of the 30S ribosomal subunit confer resistance to streptomycin via the modification of the ribosomal component. This modification reduces drug binding affinity.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1366916/

Other Groups in Aminoglycoside-resistant 16S ribosomal subunit protein

Sequences

Download Sequences

>>MEG_6144|Drugs|Aminoglycosides|Aminoglycoside-resistant_16S_ribosomal_subunit_protein|RPSL|RequiresSNPConfirmation
ATGCCAACCATCCAGCAGCTGGTCCGCAAGGGTCGTCGGGACAAGATCAGTAAGGTCAAGACCGCGGCTCTGAAGGGCAG
CCCGCAGCGTCGTGGTGTATGCACCCGCGTGTACACCACCACTCCGAAGAAGCCGAACTCGGCGCTTCGGAAGGTTGCCC
GCGTGAAGTTGACGAGTCAGGTCGAGGTCACGGCGTACATTCCCGGCGAGGGCCACAACCTGCAGGAGCACTCGATGGTG
CTGGTGCGCGGCGGCCGGGTGAAGGACCTGCCTGGTGTGCGCTACAAGATCATCCGCGGTTCGCTGGATACGCAGGGTGT
CAAGAACCGCAAACAGGCACGCAGCCGTTACGGCGCTAAGAAGGAGAAGGGCTGA