MEGAResFrom MEG, the Microbial Ecology Group

TLYA

Resistance to aminoglycoside antibiotics can be conferred via overexpression of the MexXY-OprM efflux pump. This has been described via loss-of-function mutations in the MexZ gene, which is a repressor of the mexXY operon, resulting in overexpression of the pump.

References

Sequences

Download Sequences

>CARD|pvgb|AE000516|1908741-1909548|ARO:3003445|Mycobacterium|Aminoglycosides|Aminoglycoside-resistant_16S-23S_rRNA_O-methyltransferases|TLYA|RequiresSNPConfirmation
GTGGCACGACGTGCCCGCGTTGACGCCGAGCTGGTCCGGCGGGGCCTGGCGCGATCACGTCAACAGGCCGCGGAGTTGAT
CGGCGCCGGCAAGGTGCGCATCGACGGGCTGCCGGCGGTCAAGCCGGCCACCGCCGTGTCCGACACCACCGCGCTGACCG
TGGTGACCGACAGTGAACGCGCCTGGGTATCGCGCGGAGCGCACAAACTAGTCGGTGCGCTGGAGGCGTTCGCGATCGCG
GTGGCGGGCCGGCGCTGTCTGGACGCGGGCGCATCGACCGGTGGGTTCACCGAAGTACTGCTGGACCGTGGTGCCGCCCA
CGTGGTGGCCGCCGATGTCGGATACGGCCAGCTGGCGTGGTCGCTGCGCAACGATCCTCGGGTGGTGGTCCTCGAGCGGA
CCAACGCACGTGGCCTCACACCGGAGGCGATCGGCGGTCGCGTCGACCTGGTAGTGGCCGACCTGTCGTTCATCTCGTTG
GCTACCGTGTTGCCCGCGCTGGTTGGATGCGCTTCGCGCGACGCCGATATCGTTCCACTGGTGAAGCCGCAGTTTGAGGT
GGGGAAAGGTCAGGTCGGCCCCGGTGGGGTGGTCCATGACCCGCAGTTGCGTGCGCGGTCGGTGCTCGCGGTCGCGCGGC
GGGCACAGGAGCTGGGCTGGCACAGCGTCGGCGTCAAGGCCAGCCCGCTGCCGGGCCCATCGGGCAATGTCGAGTACTTC
CTGTGGTTGCGCACGCAGACCGACCGGGCATTGTCGGCCAAGGGATTGGAGGATGCGGTGCACCGTGCGATTAGCGAGGG
CCCGTAGT