MEGAResFrom MEG, the Microbial Ecology Group

NPMA

The npmA gene encodes a methyltransferase that methylates the N1 position on A1408 and causes resistance to aminoglycoside antibiotics. This resistance mechanism has been rarely described in the literature.

References

Other Groups in 16S rRNA methyltransferases

Sequences

Download Sequences

>810|AB261016.1|AB261016|Aminoglycosides|16S_rRNA_methyltransferases|NPMA
TTGTTAATACTCAAAGGAACAAAGACGGTTGATTTATCAAAAGATGAATTGACAGAAATAATAGGTCAGTTTGATCGTGT
GCATATAGATTTGGGTACTGGAGACGGTAGAAATATATATAAACTTGCAATTAATGATCAAAACACTTTCTATATCGGAA
TAGATCCGGTAAAAGAAAACTTGTTTGATATATCCAAAAAAATTATAAAGAAGCCCTCAAAAGGAGGGCTATCTAATGTG
GTGTTTGTTATTGCAGCTGCAGAGTCTCTCCCTTTTGAATTGAAAAACATTGCTGATTCAATTTCCATTTTGTTTCCTTG
GGGGACATTGCTTGAATATGTAATTAAACCGAATAGAGATATTCTTTCGAATGTTGCAGATTTGGCTAAAAAAGAAGCTC
ACTTTGAATTTGTGACCACATACTCAGATTCATACGAAGAAGCGGAAATAAAAAAAAGAGGACTTCCTCTTTTAAGTAAG
GCCTATTTTTTGAGCGAACAATACAAAGCTGAATTATCAAACTCAGGTTTTCGCATTGATGATGTTAAGGAATTGGACAA
TGAGTATGTAAAACAGTTTAATTCTCTTTGGGCAAAGCGATTAGCTTTTGGGCGAAAACGTTCTTTCTTTCGAGTTTCTG
GCCATGTTTCAAAACATTAA