MEGAResFrom MEG, the Microbial Ecology Group

NPMA

The npmA gene encodes a methyltransferase that methylates the N1 position on A1408 and causes resistance to aminoglycoside antibiotics. This resistance mechanism has been rarely described in the literature.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/24398977

Other Groups in 16S rRNA methyltransferases

Sequences

Download Sequences

>>MEG_4215|Drugs|Aminoglycosides|16S_rRNA_methyltransferases|NPMA
TTGTTAATACTCAAAGGAACAAAGACGGTTGATTTATCAAAAGATGAATTGACAGAAATAATAGGTCAGTTTGATCGTGT
GCATATAGATTTGGGTACTGGAGACGGTAGAAATATATATAAACTTGCAATTAATGATCAAAACACTTTCTATATCGGAA
TAGATCCGGTAAAAGAAAACTTGTTTGATATATCCAAAAAAATTATAAAGAAGCCCTCAAAAGGAGGGCTATCTAATGTG
GTGTTTGTTATTGCAGCTGCAGAGTCTCTCCCTTTTGAATTGAAAAACATTGCTGATTCAATTTCCATTTTGTTTCCTTG
GGGGACATTGCTTGAATATGTAATTAAACCGAATAGAGATATTCTTTCGAATGTTGCAGATTTGGCTAAAAAAGAAGCTC
ACTTTGAATTTGTGACCACATACTCAGATTCATACGAAGAAGCGGAAATAAAAAAAAGAGGACTTCCTCTTTTAAGTAAG
GCCTATTTTTTGAGCGAACAATACAAAGCTGAATTATCAAACTCAGGTTTTCGCATTGATGATGTTAAGGAATTGGACAA
TGAGTATGTAAAACAGTTTAATTCTCTTTGGGCAAAGCGATTAGCTTTTGGGCGAAAACGTTCTTTCTTTCGAGTTTCTG
GCCATGTTTCAAAACATTAA