MEGAResFrom MEG, the Microbial Ecology Group

ARMA

The armA gene (aminoglycoside resistance methyltransferase A) encodes a methyltransferase that methylates the N7 position on guanine 1405 and causes resistance to aminoglycoside antibiotics. This is the most widely described methyltransferase that confers aminoglycoside resistance.

References

Other Groups in 16S rRNA methyltransferases

Sequences

Download Sequences

>669|AY220558.1|AY220558|Aminoglycosides|16S_rRNA_methyltransferases|ARMA
ATGGATAAGAATGATGTTGTTAAGAAGATACTTGAATCAAAAAAGTACGAAAACCTTGATTCAGATATTGTTGAAAAGGT
TGTTTCCATTTCTGAGAAGAAATATAAATTAAAGGAAGTTGAGAATTATTCTAAAAAGAAATTGCATCAAATATGGGGGT
CTTACTATTCTGCCTATCCTAATTGGGATAAATTATTAAAAAAGTACAATCAGGGGCAGTTATCAATAGAAGATTTACTA
AAGATTCATTCTTCGACGAATGAAAGAGTCGCAACATTAAATGACTTTTACACTTATGTATTTGGAAATATCAAACATGT
CTCATCTATTTTAGATTTTGGTTGTGGCTTCAATCCATTAGCTTTATACCAATGGAATGAAAATGAAAAAATAATATATC
ATGCATACGATATTGATAGAGCTGAGATAGCTTTTTTGAGTAGCATTATTGGGAAGTTAAAGACGACGATAAAGTATAGG
TTTTTGAATAAAGAGAGTGATGTCTACAAAGGTACTTATGATGTAGTATTCCTTTTAAAGATGCTTCCTGTGCTAAAACA
GCAAGATGTAAATATCTTGGATTTCCTACAGCTTTTTCATACTCAAAACTTTGTAATATCTTTTCCAATAAAGTCTTTAT
CTGGAAAGGAGAAGGGAATGGAAGAGAATTACCAGCTATGGTTTGAATCTTTTACAAAAGGTTGGATAAAAATCCTTGAT
TCGAAGGTTATAGGGAATGAGTTAGTATATATTACTAGTGGATTTCAGAAATAA