MEGAResFrom MEG, the Microbial Ecology Group

NOVA

The novA gene encodes a type III bacterial ABC transporter that is implicated in the active extrusion of novobiocin, an Aminocoumarin antibiotic. Removal of the antibiotic results in resistance to the drug.

References

Sequences

Download Sequences

>ACou|AF170880.4|gene1|Aminocoumarins|Aminocoumarin_efflux_pump|NOVA
ATGAAGTCCGCACTCTCGACCTGGAAGCCCTCGGACCGGCCGCCGGATCCGACACTGCCCGAGCCGCCGGCCCAGCTGCG
CCGCATCTTCCGGCTCTTCCGCCCGTACCGCGGCAGGCTCGCCGTCGTCGGCCTGCTCGTCGGCGCCTCGTCGCTGGTGG
CCGTCGCCTCGCCGTTCATGCTGCGCGAGATCCTCGACACCGCGATCCCGCAGGGCCGCACCGGGCTGCTCAGCCTGCTC
GCCCTCGGCATGATCCTGACCGCCGTCCTCAGCAGCGTCTTCGGCGTCGTCCAGACCCTCATCTCCACGACGGTCGGCCA
GCGCGTCATGCACGACCTGCGCACCGCCGTCTACGCGCAGCTCCAGCGCATGCCCCTCGCGTTCTTCACCCGCACCCGCA
CCGGTGAGGTCCAGTCCCGGATAGCCAACGACATCGGCGGCATGCAGGCGACCGTCACCTCAACCGCCACGTCGCTGGTC
TCCAACCTCACCGCCGTCATCGCCACCGTCGTCGCGATGCTCGCGCTGGACTGGCGGCTGACCGTCGTCTCGCTGCTCCT
GCTGCCGGTGTTCGTCTGGATCAGCCGCCGCGTCGGCCGTGAGCGCAAACGGATCACCCTGCAACGGCAGAAGCAGATGG
CCACGATGGCCGCCACGGTCACGGAGTCGCTGTCGGTCAGCGGCATCCTCCTCGGCCGCACGATGGGGCGCGCCGACTCG
CTCACCAGATCCTTCGCCGAGGAGTCCGAGCGACTCGTCGACCTGGAGGTCCGCTCCAACATGGCCGGGCGGTGGCGGAT
GTCCGTCATCGGCATCGTCATGGCCGCCATGCCCGCCGTCATCTACTGGGCGGCCGGCTTCGTCCTCCAGTCCGGCGGCA
CGGTCGTCTCCATCGGCACACTCGTCGCCTTCGTCTCCCTCCAGCAGGGCCTCTTCCGCCCGGCCGTGAGCCTGCTCGCC
ACCGGCGTGCAGATGCAGACGTCCCTCGCGCTCTTCCAGCGCATCTTCGAATATCTCGACCTGCCCGTCGACATCACCGA
ACCCGAGCGTCCGGTGGCCCTCGACAAGGTCCGGGGCGAAGTGCGCTTCGACGGCGTCGACTTCAGTTACGAGGAGAAGG
ACGGCAACACCCTCCACGGCCTGGATCTGACCGTCCCGGCCGGCGGCAGCCTCGCCGTCGTCGGTCCCACCGGATCGGGC
AAGTCGACCCTGAGCTATCTCGTGCCGCGTCTGTACGACGTGACGGGCGGCCGGGTCCTGCTCGACGGCGTCGACGTACG
CGACCTGGCCTTCGACACCCTCGCCCGCGCGGTGGGCGTCGTGTCGCAGGAGACGTATCTCTTCCACGCCTCCGTCGCCG
ACAACCTCCGCTTCGCCAAACCGGACGCGACGGACGAGGAGATCGAGAAGGCGGCCAGGGCCGCCCAGATCCACGAGCAC
ATCGTCACCCTGCCCGACGGGTACGACACACTGGTCGGCGAGCGCGGATACCGGTTCTCCGGCGGCGAGAAACAGCGCCT
CGCGATCGCCCGCACCATCCTGCGCGACCCGCCCGTCCTCGTGCTGGACGAGGCGACGAGCGCGCTCGACACCCGTACCG
AACACGCGGTCCAGCAGGCCATCGACTCCCTCTCCGAGGGCCGTACGACCATCACCATCGCCCACCGGCTCTCCACGGTG
CGCGACGCCGACCAGATCGTCGTCCTCGACGCCGGTCGCATAGCCGAGCGCGGCACGCACGAGGAGCTGATCGACCGGGA
CGGCAGGTACGCGGCGCTCGTCCGCCGGGACGGCGCGCCGGCGCCCGCGCCCGTGCCCGCCCGGGACGAGCGCGTGGGCG
CCGCCTGA