MEGAResFrom MEG, the Microbial Ecology Group

gyrB

GyrA and B are the two components of the bacterial DNA gyrase (topoisomerase IIa). Mutations in these proteins can cause resistance to fluoroquinolones via evasion of the mechanism of action. Since the aminocoumarins also affect GyrB, resistance to the aminocoumarins can also be mediated through mutations in gyrB.

References

Other Groups in Aminocoumarin-resistant DNA topoisomerases

Sequences

Download Sequences

>ACou|AF329398.1|gene37|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|gyrB|RequiresSNPConfirmation
GTGACCACTTACGACACTCGCACCGCCACCGATACCCCCGGATCCCAGCAGCCCGGCCACGTGGGGGCGGCGTCGTATGA
CGCCAACGCGATCACTGTTCTGGACGGCCTGGACGCCGTACGCAAGCGGCCCGGGATGTACATCGGCTCGACGGGAGAGC
GGGGGCTCCATCACCTGGTGCAGGAGCTCGTGGACAACTCCGTGGACGAGGCACTCGCGGGGGTGGCTGACCGGATCGAC
GTGACGATCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAATGGCCGCGGCATCCCGGTGGGGACGCACCCGGTGGAGAA
GCGGCCGGCCGTCGAGGTGGTGCTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTATGCGGTCTCCGGCG
GTCTGCACGGTGTGGGTCTGTCGGTGGTCAACGCCCTGTCGACCCGGCTTTCGGCGGAGATCTGGACCGACGGCTACCGG
TGGACGCAGGACTACAGGGACGGCGCTCCCACCGCTCCGCTGGCCCGCCACGAGGCCACCTCCAGGACAGGCACCTCGCT
GACGTTCTGGGCAGACGGCGACATCTTCGAGACCACCGAATACTCCTTCGAGACGCTGGCCAGGCGTTTCCAGGAGATGG
CCTTCCTCAACCGCGGGCTCACCCTGACGCTCACGGACGAACGGCCCTCCGCGCGCGCGACGGCCGCGGCCGACGAGGCC
GACTCGGACCCGGCAGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGCCTACCTCAATTCCCG
CAAGGGCGAACCGGCCCATCCCTCGGTCATCACTATCGCCGCAGAGGACACGGAACGGCTGCTGTCGGCCGAGGTCGCCC
TGCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCCTACGCCAACGGGATCCACACCCATGAGGGCGGCACCCATGAG
GAGGGCTTCCGTACGGCCCTGACCACCGTGGTCAACCGCTACGCGCGGGAGAAGAAGCTGCTGCGGGAGAAGGACGCGAA
CCTCTCCGGCGAGGACGTCCGCGAGGGCCTGACCGCGATCATCTCGGTCAAGCTCGGCGAGCCGCAGTTCGAGGGCCAGA
CGAAGACCAAACTCGGCAACACCGAGGCGCGCACCTTCGTTCAGAAGATCGTCCACGAGCATCTGACCGACTGGTTCGAC
CGCAACCCGAACGAGGCCGCGGACATCGTGCGCAAGGCCATCCAGGCGGCCACGGCCCGGGTCGCGGCCCGCAAGGCGCG
CGACCTGACCCGCCGCAAGGGCCTGCTGGAAACGGCGGCGCTACCGGGCAAGCTGTCCGACTGTCAGTCGAACGACCCGG
CGATGTCGGAGATCTTCGTCGTTGAAGGAGACTCCGCCGGCGGCTCGGCCAAGTCCGGCCGCAACCCGCAGTACCAGGCG
ATCCTCCCGATCCGCGGCAAGATCCTCAACGTGGAGAAGGCCCGGATCGACAAAATTCTGCACAACCAGGAGATCCAGGC
GCTCATCTCCGCGTTCGGCACGGGCGTGCACGAGGACTTCGACATCGCCAAGCTCCGCTACCACAAGATCATTTTGATGG
CGGACGCCGATGTCGACGGCCAGCACATCAACACCCTGCTGCTGACCTTCCTGTTCCGCTTCATGCGGCCACTGGTCGAG
GAGGGTCACGTCTACCTCTCCCGCCCCCCGCTGTACAA

>ACou|AF205854.1|orf0|gene|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|gyrB|RequiresSNPConfirmation
GTGACTTCTTACGACACCCGCACCGCCACCGACACCCCCGGACCCCAACTGCCCGGCCAGGTGGGGACGGCGTCGTACGA
CGCCGACGCGATCACCGTGCTGGACGGCCTGGACGCCGTACGCAAGCGGCCCGGGATGTACATCGGCTCCACGGGGGAGC
GGGGGCTCCATCACCTGGTGCAGGAACTCGTGGACAACTCGGTGGACGAGGCACTCGCGGGGGTGGCCGACCGGATCGAC
GTGACGGTCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAACGGCCGCGGCATCCCGGTGGGGATGCACCCGGTGGAGAA
GCGGCCGGCCGTCGAGGTCGTACTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTACACGGTCTCCGGCG
GACTGCACGGCGTGGGTCTGTCGGTGGTCAACGCCCTGTCGGCCAGGCTGTCGGCGGAGATCTGGACGGACGGCCACCGC
TGGACGCAGGACTACCGGGACGGCGCTCCCACCGCCCCACTGGTCCGCCGGGAGGCCACCTCCCGCACGGGCACCTCACT
GACCTTCTGGGCGGACGGCTCCATCTTCGAGACCACCGACTACTCCTTCGAGACGCTGGCCAGGCGTTTCCAGGAGATGG
CCTTCCTCAACCGTGGGCTCACGCTGACCCTCACCGACGAACGGGCCTCCGCGCGCGCCACGGCCGCGACCGACGAGGTC
CACCCGGACCCGGCGGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGCGTATCTCAACTCCCG
CAAGGGCGAACCGGTCCATCCCTCGGTCGTCACCATCGCCGCCGACGACACGGAGCGGCTGCTGTCGGCCGAGATCGCGC
TCCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCGTACGCCAACGCGATCCACACCCACGAGGGCGGCACCCACGAG
GAGGGCTTCCGTACGGCCCTGACCACCGTGGTCAACCGCTACGCGCGGGACAAGAAGCTGCTGCGGGAGAAGGACGCGAA
CCTCGCCGGCGAGGACATCCGTGAGGGGCTGACCGCGATCATCTCGGTCAAGCTCAGAGAACCGCAGTTCGAGGGCCAGA
CCAAGACCAAACTCGGCAACACGGAGGTGCGCACCTTCGTCCAGAAGGTCGTCCACGAGCATCTGACCGACTGGTTCGAC
CGCAACCCGAACGAGGCCGCGGACATCGTGCGCAAGGCCGTTCAGGCCGCCACGGCCCGGGTCGCGGCCCGTAAGGCGCG
GGATCTGACCCGCCGTAAGGGCCTGCTGGAGACGGCGTCGCTGCCGGGCAAGCTGTCGGACTGTCAGTCGAACGACCCGG
CGATGTCGGAGATCTTCATCGTCGAGGGAGACTCCGCCGGCGGCTCGGCCAAATCCGGCCGCAATCCGCAGTACCAGGCG
ATCCTCCCGATCCGGGGGAAGATCCTCAATGTCGAGAAGGCGCGGATCGACAGGATTTTGCAGAACCAGGAGATCCAGGC
GCTCATCTCCGCGTTCGGCACGGGTATGCACGAGGACTTCGACATCGCCAAGCTCCGCTACCACAAGGTCATCTTGATGG
CGGACGCCGACGTCGACGGCCAGCACATCAACACCCTGCTGCTGACCGTCCTGTTCCGCTTCATGCGGCCACTGATCGAG
GAGGGGCACGTCTACCTCTCGCGCCCGCCGCTCTACAAGATCAAGTGGAGCCGGGACCACGTCGAGTACGCCTACTCCGA
CCGCGAACGCGACACGCTGCTGGAACTGGGCCGTCGGGACGGCCGCAGGGTCAGGGACGACTCCATCCAGCGCTTCAAGG
GCCTCGGCGAGATGAACGCCGAGGAACTGCGCGTCACCACCATGGACCCCGACCACCGGGTGCTGGGGCGGGTCGCCCTC
GACGACGCGGCCGTCGCCGACGACCTCTTCTCGGTTCTGATGGGTGAGGACGTGGAAGCCCGCCGCCACTTCATCCAGCG
CAACGCCAAGGACGTCCGCTTCCTCGACATCTGA

>CARD|pvgb|NC_008783|1406995-1409425|ARO:3003302|Bartonella|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|gyrB|RequiresSNPConfirmation
ATGAGTGATGAAACAACCTCACCGACATCTGGTGACTATGGTGCCGCTTCTATCAAGGTTCTCAAAGGTCTTGATGCTGT
CCGTAAACGTCCTGGTATGTACATCGGTGATACCGACGACGGTTCAGGCTTACACCATATGGTTTATGAAGTCGTCGACA
ACGCTATTGATGAAGCATTAGCTGGCTACGCAACTCTTGTAAATGTTACGCTCCATGCCGATGGATCCTGTTCTGTTTGT
GATAATGGACGTGGAATTCCAACTGATATTCACCCAACAGAACATGTATCAGCTGCTGAAGTGATCATGACGCAACTTCA
TGCTGGTGGAAAATTTGATCAAAATTCTTATAAAGTTTCAGGGGGATTACACGGCGTTGGTGTCTCTGTTGTTAATGCAC
TATCGGTTTGGTTGCGCCTTCGAATCAAGCGTGATGGTAAAATCCATGAAATGTCGTTTACTCATGGAGTGGCTGATGCT
CCGCTCAAAGTCGTTGGTCAATGCGGTACAGAAAGTGGCACAGAAATCAGCTTTTTACCAAGCCCCGAAACCTTCACCAT
GGTTAAATTTGATTTCGAAACATTAGAGCGTCGTCTTAGAGAATTAGCTTTTTTGAATTCTGGTGTACACATTCTTCTTG
TTAACCAACACCATGCTGATGTTCGATCAGTAGAATTATATTACGAAGGTGGATTAATTGAATTTATCAAATATATTGAC
CAATCAAAAAAACCCTTAATTGATGCACCGATTTACATCACAAGCGAAAAAGATGGGATCAGTGTAGATGTTGCTTTATG
GTGGAACGATTCTTATCATGAGAAAGTATTGTGTTTCACCAATAATATTCCTCAACGCGATGGAGGAACCCATTTAGCGG
GATTCCGCAGCGCCTTAACACGTCAAATTAACGGTTATGCTGAATCCTCAGGCATTGCAAAAAAAGAAAAAGTTAATTTA
ACTGGCGATGATTGCCGTGAAGGACTCACAGCCATTCTTTCCGTTAAAGTTCCCGATCCAAAATTTTCTTCACAGACAAA
GGATAAATTGGTTTCTTCTGAAGTCCGTCCAATTGTTGAAAATTTGGTAAATGAAGGACTTTCAGCATGGCTAGAAGAAC
ACCCTAATGAAGCAAAAATTCTCATTAGCAAAGTTGTAGAAGCTGCTGCAGCGCGCGAAGCAGCACGCAAAGCGCGTGAA
CTTACACGGCGAAAAGGAGCTCTCGATATCACTTCTTTACCAGGTAAACTTGCTGATTGTCAGGAACGTGATCCTACAAA
ATCAGAAATTTTTATCGTCGAGGGGGATTCAGCTGGTGGTTCAGCTAAAAGCGGACGTTCACGCCAAAATCAAGCAATTT
TGCCTTTACGCGGTAAAATTCTTAATGTCGAACGAGCACGTTTCGACCGAATGCTTTCATCCGAAATGATTGGTACGCTT
ATTACTGCCCTTGGAACCTCTATTGGTAAGGATGAATTTTCACCTGATAAATTGCGTTATCACAAAATCATCATTATGAC
AGATGCAGATGTTGATGGCGCTCATATTCGCACCTTGCTTCTCACTTTCTTTTTCAGACAAATGCCTGAATTAATTGAAC
GTGGTCATCTTTATATCGCGCAACCACCTCTTTATAAAGTATCACGTGGTAAATCCTCTCAGTACATTAAAAATGAAGCA
GCATTTGAAGATTTCTTAATTGATAGTGGTTTGGAAGAAACAACATTAGAATTATCAAGTGGTGAGGTTTGTGCAGGCAT
TGATTTACGCCAATTCGTCCAAGATGCCCGTTTGTTGCGCCAACTCTTAAACGGTCTCCATACCCGCTATGACCGCAATA
TTGTTGAGCAAGCAGCAATCGCTGGTGCTTTCAATTTTGAGGCTTTTGCAACACCAGAAACAGCACAAAAAATAGCGGAT
ACGATAGCAAAACGTCTTGATTTAATTGCTGATGATATGGAACGTGGTTGGAGCGGTCAATATACATCAGATGGAAGTTT
ATGCTTTGAACGCGTTTTGCGCGGAGTTAAAGATGTTATTACTCTTGATGCAGGGTTTATAAATTCAGCAGATGCACGCC
AAATTGGTCATATTGCCAAAAATCTCAAAGACATCTATCGTGATCCTCCTCTTTTGCGTCGCAAAGATAAGTCAGAACGC
ATTTTTGGTCCTACGAGTTTATTGGAAAGTATTTTTATAAACGGTAAAAAAGGTATTACTTTACAGCGTTACAAAGGCCT
TGGAGAAATGAATGCTGATCAGCTTTGGGAAACAACTCTTGATCCTGATGCGCGTTCTCTTTTACAAGTTAAAATCAATG
ACGCAACTGATGCAGATTCTCTCTTCTCCCAGTTAATGGGTGATGAAGTTGAACCACGGCGAATTTTTATTCAAAAAAAT
GCCCTAAACGTTGCTAATCTTGATATCTAAG

>CARD|pvgb|NC_002952|5036-6968|ARO:3003301|Staphylococcus|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|gyrB|RequiresSNPConfirmation
GTGACTGCATTGTCAGATGTAAACAACACGGATAATTATGGTGCTGGGCAAATACAAGTATTAGAAGGTTTAGAAGCAGT
ACGTAAAAGACCAGGTATGTATATAGGATCGACTTCAGAGAGAGGTTTGCACCATTTAGTGTGGGAAATTGTCGATAATA
GTATCGATGAAGCATTAGCTGGTTATGCAAATCAAATTGAAGTTGTTATTGAAAAAGATAACTGGATTAAAGTAACGGAT
AACGGACGTGGTATCCCAGTTGATATTCAAGAAAAAATGGGACGTCCAGCTGTCGAAGTTATTTTAACTGTTTTACATGC
TGGTGGTAAATTCGGCGGTGGCGGATACAAAGTATCTGGTGGTTTACATGGTGTTGGTTCATCAGTTGTAAACGCATTGT
CACAAGACTTAGAAGTATATGTACACAGAAATGAGACTATATATCATCAAGCATATAAAAAAGGTGTACCTCAATTTGAC
TTAAAAGAAGTTGGCACAACTGATAAGACAGGTACTGTCATTCGTTTTAAAGCAGATGGAGAAATCTTCACAGAGACAAC
TGTATACAACTATGAAACATTACAGCAACGTATTAGAGAGCTTGCTTTCTTAAACAAAGGAATTCAAATCACATTAAGAG
ATGAACGTGATGAAGAAAACGTTAGAGAAGACTCCTATCACTATGAGGGCGGTATTAAATCTTATGTTGAGTTATTGAAC
GAAAATAAAGAACCTATTCATGATGAGCCGATTTATATTCATCAATCTAAAGATGATATTGAAGTAGAAATTGCGATTCA
ATATAACTCAGGATATGCCACAAATCTTTTAACTTACGCAAATAACATTCATACGTACGAAGGTGGTACGCATGAAGACG
GATTCAAACGTGCATTAACGCGTGTCTTAAATAGTTATGGTTTAAGTAGCAAGATTATGAAAGAAGACAAAGATAGACTT
TCTGGTGAAGATACACGTGAAGGTATGACAGCAATTATATCTATCAAACATGGTGATCCTCAATTCGAAGGTCAAACGAA
GACAAAATTAGGTAATTCTGAAGTGCGTCAAGTTGTAGATAAATTATTCTCAGAGCACTTTGAACGATTTTTATATGAAA
ATCCACAAGTCGCACGTACAGTGGTTGAAAAAGGTATTATGGCGGCACGTGCACGTGTTGCTGCGAAAAAAGCGCGTGAA
GTAACACGTCGTAAATCAGCGTTAGATGTAGCAAGTCTTCCAGGTAAATTAGCCGATTGCTCTAGTAAAAGTCCTGAAGA
ATGTGAGATTTTCTTAGTCGAAGGGGACTCTGCCGGGGGGTCTACAAAATCTGGTCGTGACTCTAGAACGCAGGCGATTT
TACCATTACGAGGTAAGATATTAAATGTTGAAAAGGCACGATTAGATAGAATTTTGAATAACAATGAAATTCGTCAAATG
ATCACAGCATTTGGTACAGGAATCGGTGGCGACTTTGATCTAGCGAAAGCAAGATATCACAAAATCGTCATTATGACTGA
TGCCGATGTGGATGGAGCGCATATTAGAACATTGTTATTAACATTCTTCTATCGATTTATGAGACCGTTAATTGAAGCAG
GCTATGTGTATATTGCACAGCCACCGTTGTATAAACTGACACAAGGTAAACAAAAGTATTATGTATACAATGATAGGGAA
CTTGATAAACTTAAATCTGAATTGAATCCAACACCAAAATGGTCTATTGCACGATACAAAGGTCTTGGAGAAATGAATGC
AGATCAATTATGGGAAACAACAATGAACCCTGAGCACCGCGCTCTTTTACAAGTAAAACTTGAAGATGCGATTGAAGCGG
ACCAAACATTTGAAATGTTAATGGGTGACGTTGTAGAAAACCGTAGACAATTTATAGAAGATAATGCAGTTTATGCAAAC
TTAGACTTCTAAG

>ACou|AF235050.4|gene33|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|gyrB|RequiresSNPConfirmation
GTGACTACTTACGACACTCGCACCGCCACCGACACCCGCGGATCCGAGCAGCCCGGCCACGTGGGGACGGCGTCGTATGA
CGCCAACGCGATCACCGTTCTGGACGGCCTGGACGCCGTACGCAAACGGCCCGGGATGTACATCGGCTCTACCGGGGAGC
GGGGGCTCCATCACCTGGTGCAGGAGCTCGTGGACAACTCCGTGGACGAGGCACTCGCGGGGGTGGCCGACCGGATCGAC
GTGACGGTCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAACGGCCGCGGCATCCCGGTGGGGATGCACCCGGTGGAGAA
GCGGCCGGCCGTCGAGGTGGTGCTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTACGCGGTCTCCGGCG
GTCTGCACGGTGTGGGTCTGTCGGTGGTCAACGCCCTGTCGACCCGGCTGTCGGCGGAGATCTGGACCGACGGCCACCGG
TGGACGCAGGACTACAGGGACGGCGCTCCCACCGCCCCACTGGCCCGCCACGAGGCCACCTCCCGGACGGGCACCTCGCT
GACGTTCTGGGCGGACGGCGACATCTTCGAGACCACCGAATACTCCTTCGAGACGCTGGCCAGGCGTCATCAGGAAATGG
CCTTCCTCAATGGTGGGCTCACCCTGACCCTCACCGACGAACGGTCCTCCGCGCGCGCGACGGCCGCGGTCGACGAAGCC
GACTCGGACCCGACGGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGTCCACCTCAATGCCCG
CAAGGGCGAGCCGGCCCATCCCTCGGTCATCACCATCGCCGCCGAGGACACGGAACGGCTGTTGTCGGCCGAGATCGCCC
TGCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCCTACGCCAACGCGATCCACACCCATGAGGGCGGCACCCACGAG
GAGGGCTTCCGCACGGCACTGACCACCGTGGTCAACCGCTACGCGCGGGAGAAGAGGCTGCTGCGGGACAAGGACGCGAA
CCTCTCCGGCGAGGACATCCGCGAGGGTTTGACCGCGATCATCTCGGTCAAGCTCGGCGAACCGCAGTTCGAGGGCCAGA
CCAAGACCAAACTCGGCAACACCGAGGTGCGCACCTTCGTTCAGAAGATCGTCCACGAGCACCTGGCCGACTGGTTCGAC
CGCAACCCGAACGAGGCCGTGGACATCGTGCGCAAGGCCGTCCAGGCCGCCACGGCCCGGGTCGCGGCCCGCAAGGCGCG
CGACCTGACCCGCCGCAAGGGCCTGCTGGAAACGGCGGCGCTGCCGGGCAAGCTGTCCGACTGCCAGTCGAACGACCCGG
CGACGTCAGAGATCTTCATCGTCGAAGGAGACTCCGCCGGCGGCTCTGCCAAAGCCGGCCGCAATCCGCAGTACCAGGCG
ATCCTCCCGATCCGCGGCAAAATCCTGAACGTCGAGAAGGCGCGGATCGACAAAGTACTGCAGAACCAGGAGATCCAGGC
GCTCATCTCCGCGTTCGGCACGGGTGTGCACGAGGACTTCGACATCGCCAAGCTCCGTTACCACAAAATCATTCTGATGG
CGGACGCGGACGTCGACGGCCAGCACATCAGCACCCTGCTGCTGACCTTCCTCTTCCGCTTCATGCGGCCACTGGTCGAG
GAGGGGCACGTCCACCTCTCCCGACCGCCGCTGTACAAGATCAAGTGGAGTCGGGAACACGTCGAATACGCCTACTCCGA
CCGCGAACGCAACACACTCCTGGAACGGGGCCGCCGGGACGGCCGCCGGATCAGGGACGACTCCATCCAGCGCTTCAAGG
GTCTGGGCGAGATGAACGCCGAGGAACTGCGCGTCACCACCATGGACCCCGACCACCGGGTCCTGGGACAGGTCACCCTC
GACGACGCGGCTTTCGCCGACGACCTCTTCTCCGTCCTGATGGGCGAGGACGTGGAAGCCCGCCGCCACTTCATCCAGCG
CAACGCCCAGGACGTCCGCTTCCTCGACATCTGA

>ACou|AY136281.1|gene1|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|gyrB|RequiresSNPConfirmation
GTGACCACTTACGACACTCGCACCGCCACCGATACCCCCGGATCCCAGCAGCCCGGCCACGTGGGGGCGGCGTCGTATGA
CGCCAACGCGATCACTGTTCTGGACGGCCTGGACGCCGTACGCAAGCGGCCCGGGATGTACATCGGCTCGACGGGAGAGC
GGGGGCTCCATCACCTGGTGCAGGAGCTCGTGGACAACTCCGTGGACGAGGCACTCGCGGGGGTGGCTGACCGGATCGAC
GTGACGATCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAATGGCCGCGGCATCCCGGTGGGGACGCACCCGGTGGAGAA
GCGGCCGGCCGTCGAGGTGGTGCTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTATGCGGTCTCCGGCG
GTCTGCACGGTGTGGGTCTGTCGGTGGTCAACGCCCTGTCGACCCGGCTTTCGGCGGAGATCTGGACCGACGGCTACCGG
TGGACGCAGGACTACAGGGACGGCGCTCCCACCGCTCCGCTGGCCCGCCACGAGGCCACCTCCAGGACAGGCACCTCGCT
GACGTTCTGGGCAGACGGCGACATCTTCGAGACCACCGAATACTCCTTCGAGACGCTGGCCAGGCGTTTCCAGGAGATGG
CCTTCCTCAACCGCGGGCTCACCCTGACGCTCACGGACGAACGGCCCTCCGCGCGCGCGACGGCCGCGGCCGACGAGGCC
GACTCGGACCCGGCAGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGCCTACCTCAATTCCCG
CAAGGGCGAACCGGCCCATCCCTCGGTCATCACTATCGCCGCAGAGGACACGGAACGGCTGCTGTCGGCCGAGGTCGCCC
TGCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCCTACGCCAACGGGATCCACACCCATGAGGGCGGCACCCATGAG
GAGGGCTTCCGTACGGCCCTGACCACCGTGGTCAACCGCTACGCGCGGGAGAAGAAGCTGCTGCGGGAGAAGGACGCGAA
CCTCTCCGGCGAGGACGTCCGCGAGGGCCTGACCGCGATCATCTCGGTCAAGCTCGGCGAGCCGCAGTTCGAGGGCCAGA
CGAAGACCAAACTCGGCAACACCGAGGCGCGCACCTTCGTTCAGAAGATCGTCCACGAGCATCTGACCGACTGGTTCGAC
CGCAACCCGAACGAGGCCGCGGACATCGTGCGCAAGGCCATCCAGGCGGCCACGGCCCGGGTCGCGGCCCGCAAGGCGCG
CGACCTGACCCGCCGCAAGGGCCTGCTGGAAACGGCGGCGCTACCGGGCAAGCTGTCCGACTGTCAGTCGAACGACCCGG
CGATGTCGGAGATCTTCGTCGTTGAAGGAGACTCCGCCGGCGGCTCGGCCAAGTCCGGCCGCAACCCGCAGTACCAGGCG
ATCCTCCCGATCCGCGGCAAGATCCTCAACGTGGAGAAGGCCCGGATCGACAAAATTCTGCACAACCAGGAGATCCAGGC
GCTCATCTCCGCGTTCGGCACGGGCGTGCACGAGGACTTCGACATCGCCAAGCTCCGCTACCACAAGATCATTTTGATGG
CGGACGCCGATGTCGACGGCCAGCACATCAACACCCTGCTGCTGACCTTCCTGTTCCGCTTCATGCGGCCACTGGTCGAG
GAGGGTCACGTCTACCTCTCCCGCCCCCCGCTGTACAAGATCAAGTGGGGCCGGGACCACGTCGAATACGCCTACTCCGA
TCGCGAACGCGACGTGCTCCTGGAACGGGGCCGGCAGGACGGCCGCCGGATCAAGGACGACTCCATCCAGCGCTTCAAGG
GCCTGGGCGAGATGAACGCCGAGGAACTGCGCGTCACCACCATGGACCCCGACCACCGGGTCCTGGGCCAGGTCACCCTC
GATGACGCGGCCGTCGCCGACGATCTCTTCTCCGTCCTGATGGGTGAGGACGTCGAAGCCCGCCGCCACTTCATCCAGCG
CAACGCCAAGGACGTCCGCTTCCTCGACATCTGA