MEGAResFrom MEG, the Microbial Ecology Group

PARE

The parE gene encodes a topoisomerase type IV subunit E, which aids in the decatenation (detangling) of DNA after replication and recombination but before segregation. DNA topoisomerase IV is related in structure to DNA topoisomerase II in that the parE subunit binds strongly to ATP; specific mutations in the parE gene often confer resistance to fluoroquinolones, and some have been shown to confer resistance to aminocoumarins.

References

Other Groups in Aminocoumarin-resistant DNA topoisomerases

Sequences

Download Sequences

>ACou|AE016830.1|gene1599|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCTAAAAAAATTAACAATGAGTACAATGATGCCTCTATCCAAGTCCTAGAAGGATTGGAAGCAGTGAGGAAAAGACC
TGGTATGTATATCGGTTCAACCGATAGCCGTGGACTCCATCACTTAGTCTATGAAATTGTCGATAACGCAGTCGATGAAG
CGTTATCTGGCTACGGGAATGAAATCAACGTAACTATCCAAAAAGATAATAGTATTTGTGTTGCAGACTCTGGCCGCGGA
ATGCCAACAGGGATGCATGCTTCTGGTATCCCAACAGTAGAAGTAATTTTTACTGTCTTACATGCGGGTGGTAAGTTTGG
CCAAGGTGGCTATAAAACTTCAGGCGGACTCCATGGGGTAGGTGCCAGTGTTGTTAATGCCTTATCTAAGTGGTTAGAAG
TTCATATTGTTCGTGATGGCGTAGAATACATGGAACGATTTGAGGACGGCGGTAAACCAGTTGGTACCTTAAAAAAAATC
GGCAAAACAAAAAAACGCAACGGTACCTCCGTTACTTTTTTACCTGACGACACCATTTTCTCTACGACAAATTTTTCTTA
CGAAATTTTAGCAGAACGTTTGAGAGAATCAGCTTTCTTATTAAAAGGCGTCAAAATTACTTTAACAGATGAACGTGGGG
AAGAACCCAAAGAAGAAGTCTTCCACTACGAAGAAGGTATTAAAGAATTTGTTGCCTATCTAAATGAAGAAAAAGATACA
TTAACACCCGTTGTTTATTTTTCAGGAGCCAAAGAAGGTATTGAAGTTGAATTAGCTTACCAATACAACGATGGCTATTC
TGAAAATGTTTTATCTTTCGTTAACAATGTCCGCACAAAAGATGGCGGTACCCACGAAGTCGGTATGAAAACGTCAATGA
CGAAGGCGTACAATGAATATGCACGGAAAGTGGGACTATTAAAAGAAAAAGATAAAAATTTAGAAGGTAGCGACTTCCGT
GAAGGCTTAGCAGCCGTCCTTTCTATTCGAGTACCAGAAAACTTACTACAGTTTGAGGGCCAAACCAAAGGAAAATTAGG
TACACCTTTAGCAAGAACCGTTGTCGATAACGTCGTAGGCGAACAAATGGGCTTCTATTTACAAGAAAACAGTGAAATGA
GTCAATCATTAATTCGGAAAGCGATTAAAGCCCGTGAAGCCCGTGAAGCGGCTCGTAAAGCCCGTGAAGAAAGCCGGAAC
GGTAAAAAACGGAAAAAAGGTGAATCGTTACTTTCTGGAAAATTAACACCGGCTCAATCCAGAAATCCTAAGAAAAATGA
ACTATATCTTGTCGAAGGAGACTCGGCCGGTGGCTCAGCAAAACAAGGGCGCGACCGGAAATTCCAAGCCATTTTACCGC
TACGAGGAAAAGTCATTAATACGGAAAAAGCGAAAATGCAAGACATCTTGAAAAACGAAGAAATCAATACTATGATCTAT
ACGATTGGCGCAGGCGTTGGTCCTGAATTTTCAATTGAAGATTGTAATTATGATAAAATCATCATCATGACCGATGCGGA
TACCGATGGTGCCCATATTCAAGTGTTGCTATTAACGTTCTTCTATCGTTATATGAAACCATTAATTGAAGCCGGCAAAG
TCTACATTGCCTTACCACCACTTTATAAAGTCTCTAAAGGAACTGGAAAAAAATCAGTCATTGAGTATGCTTGGACCGAT
GGTGAATTGGCAGAAGTGATTGATAAAGTTGGTAAAGGCTATATGCTCCAACGCTATAAAGGTCTGGGGGAAATGAATGC
AGAACAACTTTGGGAAACAACGATGGATCCTGAAACTAGAACCTTAATTCGTGTTCGGATTGATGATGCAGCTCAAGCAG
AACGCCGTGTGACCACATTAATGGGCGACAAAGTCGAACCTCGTCGAAAATGGATTGAACAACATGTTCAATTTACGTTG
GAAGAAGATGGCAGTATTTTAGATCGTTCAGAAGAAGACACTTCTGCACCAACAGGAGAAAGTCTTTTAGATGCGGAAAA
AACAAAAGAAGCAGAACAAACCGATGACACTGAAATCAGTTTGTTTGACATAGAGTAG

>ACou|NC_006582.1.320275|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGGCAAAACAGCACGTGGAATACAATGAGGATGCCATTCAAGTCTTAGAAGGGCTTGAAGCGGTACGCAAGCGGCCTGG
CATGTACATCGGCTCAACTGATGTACGCGGGCTGCACCATCTTGTTTATGAAATTGTCGATAATGCCGTCGATGAAGCAC
TCGGCGGCTACGGAAATACAATAAAAGTAACGATCCATAAAGATCAGAGTGTCTCGATTGAGGATGAAGGGCGGGGGATG
CCCGTCGGCATGCACCGTTCTGGAAAGCCGACACCGGAAGTCATTTTCACCGTCCTTCATGCTGGAGGCAAATTCGGCCA
AGGCGGATATGCGACAAGTGGCGGGCTGCACGGAGTTGGTGCTTCCGTTGTCAATGCCTTATCGGAATGGCTTGAAGTGG
AGATTAAACGGGATGGCTATCGATACACACAACGTTTCGAACAAGGCGGCAAGCCGGTCACAACGCTTGAGAAAAAAGGC
AAAACACGCGCCTCAGGCACGACTGTCCGTTTTAAGCCAGATGAAGGCATTTTCTCAACCATTCAGTTTAACAGCGAAAT
ATTGGCGGAAAGACTTCGAGAAGCTGCTTTTCTGTTGAAAGGCGTCCAGATTGAATTAACGGACAAGCGTCCTGAAAAAG
AGCTGCATGAAGTGTTTAAGTTTGATACGGGGCTGGAAGCCTTTGTCGACTATTTAAATGAAGGAAAAGAAGCGCTTCAT
CCAGTCGTGTCCTTTTCCGGAAGCGCCAATGACATCCAAATGGACTTTTCCTTTCAATTTCACGATGCCTATACGGAAAA
TGTGCTTTCTTTCGTTAATAATGTCCGTACACGGGACGGCGGCACACACGAGCTAGGCGCGAAAACAGCGATGACCCGCA
TCATGAATGAACACGCACGCAAAATTGGCGTTTTAAAAGAGAAAGACAAAAACTTAGATGGATCGGATATACGAGAAGGA
TTCACGGCGGTCGTCTCCGTTCGCGTCCCGGAAGCAAAACTGCAATTCGAAGGGCAAACGAAAAGCAAGCTAGGGACTCC
AGAAGCCCGTTCTGCCGTTGATGCGATAGTCTCAGAAAACCTCAGTTATTTTCTCGAAGAAAATCCAGCTGTGGCAACGA
TGCTACTTAAAAAAGCAATGAAGGCAGCACAGGCACGGGAAGCGGCACGTAAAGCCAGGGAAGACGCGCGCAACGGCAAG
AAAAACAAGCGCAAAGATGTGTTGCTGAGCGGCAAGTTAACGCCAGCTCAGTCACGGAACCCAGCTCGCAATGAACTGTA
CTTGGTCGAGGGCGACTCTGCTGGAGGCTCAGCCAAACAAGGGCGTGACCGCAAATTCCAAGCTGTTCTCCCTCTTAGAG
GAAAAGTCATCAACACCGAAAAAGCCAAGCTTGATGACATTATGAAAAATGAAGAAATCCGCACAATTATCCATACAATT
GGCGCTGGCGTAGGAGCCGATTTTGATAGTGCTGACTGTAATTACGACAAAGTTGTCATTATGACAGATGCTGATACAGA
CGGTGCTCATATTCAAGTGCTGTTGCTTACGTTTTTCTATCGCTACATGAAACCGCTCATCGACGAAGGGAAAATTTACA
TCGCCTTGCCTCCTTTATACAAAGTAAGCAAAGGCAGCGGCAAAAAAGAGCAAGTCGAGTATGCATGGGATGAAAACGAA
CTCCAGGCTGCGTTAAAGAAAGTCGGCAGGGGATCGACTGTCCAACGTTACAAAGGGCTCGGCGAAATGAACGCCACCCA
GCTATGGGAAACAACCATGGACCCAGCGACACGCACGTTGATCCGCGTCCGTTTGGAAGACGCGGCACGGGCTGAGAAAC
ATGTGGCTACGCTTATGGGCGATAAAGTCGAACCGCGCCGTAAGTGGATTGAAAGCCATGTCGCCTTTGGGCTAGAAGAA
GACACAAACATTTTGGAAAACGAGAATCTGCAAGTAGGGGAGGAAGCGTAA

>ACou|NC_003112.2.903425|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGGCTAAAAACAACCAATACAGCGAATCCAGCATCACCGTCCTCAAAGGCTTGGAGCCGGTCAAAGAACGTCCCGGTAT
GTACACCCGCACCGACAGCCCGACCCATATCTGCCAAGAAGTCATCGACAACGCGTCGGATGAAGCGTTGGGCGGTTTCG
CGACTGCAATCGACGTGCAAATTCATGAAGACGGTTCGCTTTCCGTGCACGACAATGGGCGCGGCATTCCCGTCGGCCTG
CATCCCGAAGAAGGCGTATCCGTAGTCGAACTCGTATTCACCCGTCTGCACGCAGGCGGCAAGTTCAACAAAAAAGACGG
AGGCAGCGCGTATGCCTTTTCAGGCGGCCTGCACGGCGTGGGCGTATCCGTCACCAACGCCCTTTCCACCCGCCTTGAAG
TAACGGTCAAACGCGAAGGCAAAATCCACCGCATCGTGTTTGCCGGCGGCGACGTGGTCGAACCGTTGGCACAAGTGGGC
AAATGCGCCGTCAAAGACAGCGGTACAGAAGTGCGCGTCTGGCCGGACGGCAAATATTTTGAAAGCCCGAATTACAGCAT
TCCCGAACTCGAACGCCTGCTGCGTGCCAAAGCCGTGCTGCTGCCGGGTGTGCGCGTTTCCCTGACCCGTCCGGTCAAAG
GCGAAGACGAAGCGCACACCCAAACCTGGCATTACCCCGACGGCCTGAAAAGCTATCTGACCGACCTGATTGCCGACGCG
CAGGAAGCCGTACCGCTGTTCTCTTGCGAAAACTACATTTCAGACGAACACAACGGCGATTTCAGCATCGGCGAAGGAGC
GGCGTTTGCCCTGACTTGGCTGGAAGAAGGCTCGTGCGCCAACGAAAGCTACGTCAACCTCATCCCCACCCCGCTGGGCG
GCACGCACGAAGCAGGCTTGAAACAAGCCGTGTTCAACGCAGTCAACAACTTCATCAATCTGCACAACCTCTTGCCGCGC
GGCGTTAAAGTGCAAAGCGACGACGTGTTCGGAAAAACCGCCTTCGTTCTCTCTGCCCGCGTCCTCGACCCGCAGTTCCA
AGGTCAAACCAAAGACAAGCTGACCAACCGCGACGCGCTGAAACTCGTCGCCACCGTATCGGGCGACCCTTTGGAATTGT
GGCTGAACCAAAACGTGGACTTCGGCAAAAAAATCGCCGAACTCGCCATCCGCCAAGCACAGGCGCGGATGCGTTCGGTT
AAAAAGATTGAAAAGAAAAAAGGCAGCGGCGTCGCCGTCCTGCCCGGTAAGCTGACCGACTGCGAAAGCGAAGACATCCG
CGAAAACGAACTCTTCCTCGTCGAAGGCGATTCCGCCGGCGGCTCAGCCAAACTCGCCCGCGACAAAGCCACCCAAGCCA
TCCTGCCCCTGCGCGGCAAAGTGCTCAACAGCTTTGAAGTCCACCCCGACCAACTCTTCGGCAACGCCGAAATCCACGAC
ATTTCCGTCGCCATCGGCGTCGATCCGCACGGTATTAACGACCATCCCGATTTAAGCGGCCTGCGCTACGGCAAAATCGC
CATCCTGTCCGATGCCGACGTGGACGGCTCGCATATTCAAGTTTTGCTGCTGACCCTGTTCTACCGCCACTTCCCGAAAC
TGGTTGCCGACGGACACATCTACGTCGCCCAGCCGCCACTGTTCCGCGTCGATGTCAACGCACAAGGTAAGAGCAAACCT
GCCCGCAAATTCTACGCCCTCGACCAAAACGAACTCGACAGCATTTTGGAGCGGCTGCAAAAAGAAGGCGTTAAAGAAAC
CGCCTATTCCATCAGCCGTTTCAAAGGCTTGGGCGAGATGAACCCCGACCAGCTCAAAGATACTACCATGCACCCCGACA
CCCGCCGCCTGTTGCAGGTACAAATCCCAGAAGGTGCAGATGACGAGACGCGCGACATCTTCGTCAAACTGATGGGCAAA
GGCGAAGCCGCCGCCCGCCGCGCTTGGATGGAACGCGAAGGCGATACGGCGGAATTGGATATTTGA

>ACou|NC_002952.2859942|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGCGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAATTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGACGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTACGTATTCCAGAAGAATTACTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCAAGAAGTGCTGTTGATTCAGTAGTTGCAGACAAATTACCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTAAAAAAAGCAATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAATACAGATAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTGGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAACTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTACAAAAAGAACTTGGTAAGGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATTTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|CR628337.1|gene758|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGTCAGAAAACTACACTGCGGAAGCGATTGAAGTCTTAAGTGGTCTTGAGCCTGTTCAACGACGTCCCGGTATGTATAC
CGACACGACACGCCCCAACCATTTGGCTCAGGAAGTGATTGATAATAGCGTCGATGAAGTACTTGCTGGATTTGCCAGCC
GTATTATTGTTACTTTACATGAAGACGGCTCTATTGAAGTCGAGGATGATGGCCGAGGTATGCCAGTCGATTTACACCCT
CAACTCGGCTTAAGTGGTGTCGAGGTCATTATGACTCGACTTCATGCCGGAGGTAAGTTTTCAGATAAAAATTACAGCTT
TTCCGGCGGCTTGCATGGCGTTGGGGTATCAGTGGTAAATGCCTTGTCAGAACGACTTGACGTCACCATAAAGCGCAATG
GGATCATTTATCAAATGACCTTTGCTAATGGCGACAAATTATGTGAATTAAATGAAACCGGGGTTACAAAAAAAAGAGAA
ACCGGGACTGTTATACGTTTTTGGCCTAATGGCAAATATTTTGATACTACAAAAATTTCTGTAAAACACCTGACTCATGT
ATTAAGAGCAAAAGCGGTATTGTGTAGTGGCTTGTCCATGACCTTTATCAATAAAATCACTAATGAAGAAATGAACTGGT
GTTATGAACAAGGTTTAACTGATTATTTACGGCAAACCTTGCCCGAAGACTATTTGCCTGAAGAACCTTTTGCCGGAGCA
TTCAAAAGTGATGAAGCAACCGTTGATTGGGCTTTGGCCTGGTCAGACTCTGCCAATGGCAATTTAAATGAAAGTTATGT
GAATTTAATCCCGACAATACAAGGAGGCACGCACGTCAATGGATTGCGTTCGGGATTATTTGAAGCCATGTCTGAATTTT
GTGAGCTGAGAAACCTTCTTCCTCGTGGAGTAAAATTGACAGCGGATGATCTATGGGAATCATGTCAGTATGTTTTATCA
ATCAAAATGAAAGAGCCGCAATTTGCTGGGCAAACCAAAGAGCGCTTAAGCTCACGCCAAACCTCAGGACTAGTCAGTAA
TGTCATAAAAGACGCTTTTGCAATTTGGTTGAATCAGCATCGCAACCAGGGTGAAGCCATAGCAGCTCTTGCAATAGAAC
GCGCACAGAAACGGCTAAAGCAAGCCAAACAAGTGGCACGCAAACGTGTTAGCCAAGGGCCTGCTTTACCTGGAAAATTA
GCCGACTGCTTGCAAACGGACTTAGGTCAAGCGGAACTATTCCTGGTTGAAGGAGATTCGGCAGGAGGGTCGGCCAAACA
AGCCCGCAATAAAGATTATCAAGCCATTTTACCCTTACGTGGGAAAATACTTAATTCATGGGAAGTAGATTCTTCACAAG
TTCTGGCATCCCAGGAAATTCATGATATATCTGTTGCTATAGGCGTAGATCCTGGCTCTAGCGATCTTGAGGGTCTTCGC
TATGGAAAAATCTGTATTCTTGCCGATGCAGACTCTGATGGAGCTCATATTGCCACACTAATATGTGCCTTGTTTTTAAG
ACACTTCAAACCTCTGGTTAAAGCAGGCCATGTTTTTGTAGCCATGCCCCCGCTCTATCGAATTGATGCAGGTAAGCTGA
TTCACTATGCCCTGGATGATGAAGAAAAAAATAGAATCGTTCAACATCTCAGTCAAACCACAAAATCAAAAGTGAATGTA
CAGCGATTCAAAGGATTAGGTGAAATGAATCCCATTCAGCTTAGAGAAACAACAATGGATCCCAATACAAGGCGTCTGGT
ACAGCTTACTCTTGATGATGAAGAGCAGACGGAAGCCATTATGGATATGATGCTCAACAAAAAAAGGGCCTCCGACAGAA
AACTCTGGCTAGAAACAAAAGGAAACCTTGCTGAAATTTGA

>ACou|NC_003197.1.1254704|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACGCAAACTTATAACGCTGATGCCATTGAGGTACTCACTGGGCTTGAGCCGGTACGCCGCCGCCCGGGGATGTACAC
CGATACGACCCGCCCCAACCATTTGGGTCAGGAAGTGATTGATAATAGTGTGGATGAAGCACTGGCAGGTCACGCCAAAC
GCGTGGATGTCATTTTACATGCCGATCAATCGCTGGAAGTGATTGACGACGGACGCGGGATGCCGGTGGATATCCATCCG
GAAGAGGGGGTTCCGGCGGTAGAACTGATCCTCTGTCGGCTTCATGCCGGCGGTAAATTCTCCAATAAGAACTATCAGTT
CTCTGGTGGTCTGCATGGGGTGGGGATTTCGGTAGTAAATGCCCTGTCAAAGCGCGTGGAAGTGACCGTGCGCCGCGACG
GTCAGGTCTATAACATCGCGTTTGAAAACGGCGAAAAAGTGCAGGATTTGCAGGTTGTCGGCACCTGCGGTAAACGTAAT
ACTGGAACCAGCGTCCATTTCTGGCCGGACGAAAGTTTCTTCGACAGCCCGCGTTTTTCTGTCTCTCGCTTAATGCACGT
TCTGAAAGCAAAAGCGGTGCTGTGTCCCGGCGTGGAAATCACTTTTAAAGATGAAGTGAATAACAGCGAGCAGCGCTGGT
GCTACCAGGATGGTCTGAACGACTATCTGGGCGAAGCGGTAAACGGCCTGCCGACGCTGCCGGAAAAGCCGTTTATCGGT
AATTTTAACGGTGAAACGGAAGCGGTTGACTGGGCGCTATTGTGGCTGCCGGAAGGCGGCGAATTACTGACGGAAAGCTA
CGTCAACCTGATCCCGACCATGCAGGGGGGGACGCACGTCAACGGTCTGCGCCAGGGCCTGCTCGACGCGATGCGCGAAT
TTTGCGAATACCGCAATATTCTGCCGCGCGGCGTCAAACTGTCGGCGGAAGATATCTGGGATCGCTGCGCTTATGTGCTT
TCCGTGAAAATGCAGGACCCGCAATTTGCCGGGCAGACCAAAGAGCGTCTGTCGTCGCGTCAATGTGCGGCATTTGTTTC
CGGCGTGGTGAAAGATGCCTTCAGCCTGTGGCTGAACCAGAACGTGCAGGCGGCGGAACAACTGGCAGAGATGGCGATTG
CCAGCGCGCAGCGGCGACTGCGCGCCGCAAAAAAAGTGGTGCGCAAAAAGCTCACCAGCGGCCCGGCGTTGCCGGGGAAA
CTGGCGGACTGTACCGCGCAGGATCTTAATCGGACCGAGCTGTTCCTTGTGGAAGGGGATTCGGCGGGCGGTTCCGCCAA
GCAGGCGCGCGATCGCGAATATCAGGCGATCATGCCGCTCAAAGGTAAGATCCTTAACACCTGGGAGGTCTCTTCCGATG
AAGTGCTGGCCTCGCAAGAAGTGCATGATATTTCCGTGGCGATCGGTATCGATCCGGACAGCGACGATCTGAGTCAGCTG
CGCTACGGCAAGATCTGTATCCTGGCGGATGCGGACTCCGATGGTTTGCATATCGCTACTCTGCTTTGCGCGCTGTTTGT
CAGACACTTCCGCGCGCTGGTGAAGAATGGTCATGTCTACGTCGCGCTACCGCCGCTATACCGTATCGATTTGGGTAAAG
AGGTCTATTACGCGCTGACGGAAGAAGAGAAGGCGGGCGTACTGGAACAACTGAAGCGTAAGAAAGGCAAGCCGAACGTA
CAGCGTTTCAAAGGCCTGGGAGAAATGAACCCGATGCAGTTACGCGAAACCACGCTTGATCCGAATACTCGCCGCCTGGT
GCAGCTCACCATTAGCGATGAAGACGATCAGCGTACTAATGCGATGATGGATATGCTGCTGGCGAAGAAACGTTCTGAAG
ATCGACGCAACTGGCTACAGGAAAAAGGCGATCTCGCGGATCTCGACGTGTAA

>ACou|NC_002758.1121329|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAGTATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGCGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTTCGTATTCCAGAAGAATTATTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCCCTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAACACTGAAAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTGCAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|NC_007622.3794232|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAAGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTAAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAATTTGTTGGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGATGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTCGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGACGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTATACGTATTCCAGAAGAATTACTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCAAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAATACAGATAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTGGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAACTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTACAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAAATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAATTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|NC_003923.1003353|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGCGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTACGTATTCCAGAAGAATTATTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAACACTGAAAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTACAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|CP003583.1|gene1173|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGCCGCAAAGTATTATTGAAGGAGCGTTTGCCTTGGCAAAAAAAGTAAACAACGAATACAATGACTCGTCCATCCAAGT
ATTGGAAGGATTAGAGGCAGTTAGAAAAAGACCAGGGATGTACATTGGATCCACTGACAGCCGAGGCTTGCATCATTTAG
TCTATGAAATCGTCGATAATGCAGTTGACGAAGCATTATCAGGTTATGGCAGTGAGATTGATGTGACCATCCATGAAGAC
AATAGTATAACTGTTGCAGATAGCGGACGTGGGATGCCTGTAGGAATGCATGCTTCCGGAATACCAACAGTTGAAGTGAT
TTTTACTGTGCTGCATGCTGGCGGAAAGTTTGGTCAAGGAGGGTACAAAACTTCTGGTGGACTGCACGGTGTAGGAGCCA
GTGTGGTAAATGCCTTATCGAAATGGCTAATTGTAACGATCGTTAGAGATGGCGTAGAGTATCAGCAGAAATTTAAAAAC
GGCGGTAAACCTGACGGTACTTTGAAAAAGATAGGAAAAACAAAAAAAGCAAACGGGACGACTGTCCATTTTTTACCAGA
TGATACAATATTCAGTACAACGAAATTTTCATATGAAATTTTAGCCGAACGGTTAAGAGAATCTGCCTTTCTTCTAAAAG
GCGTTAAAATCTCTCTTTCTGATCTTCGTGGAGAAGAACCAGTCAAGGAAATTTTTCATTACGAAGAAGGAATCAAAGAA
TTTGTTGATTATCTGAATGAAGAAAAAGATACATTGACACCAGTTGTTTATTTTTCAGGAGAAAAAGAAGGTATCGAAGT
AGAGGTCGCTTATCAATACAATGACGGTTATTCAGAAAATGTTTTATCTTTTGTCAATAACGTTCGGACAAAAGATGGGG
GAACCCATGAAGCTGGTATGAAAGCGGCGATGACGAAATCTTATAATGAATATGCGAGAAAAGTTGGTTTGCTGAAAGAA
CGGGACAAGAATCTGGAAGGTAGTGATTTCAGAGAAGGGTTAGCTGCTGTACTTTCTATCCGTGTACCTGAAAATCTTCT
GCAATTTGAAGGGCAAACAAAAGAAAAACTTGGTACGCCAGTTGCTCGTACCGTAGTAGATAACGTCATCAGTGAACAAA
TGGGCTTTTATTTGCAGGAAAATAGCGAAATGAGCCAGATGTTGGTCCGTAAAGCAATCAAAGCCAGAGAAGCGAGAGAA
GCAGCACGTAAAGCCAGAGAAGAAAGCCGAAATGGGAAGAAGCGTAAAAAAGGCGAATCTCTTCTTTCAGGAAAATTGAC
ACCCGCACAATCCCGAAACCCTAAGAAAAATGAATTGTATTTAGTCGAAGGGGATTCTGCTGGCGGATCTGCTAAACAAG
GAAGAGACAGAAAGTTCCAAGCAATTCTACCTTTACGAGGAAAAGTCATCAATACCGAAAAAGCTAAAATGCAAGATATC
TTGAAAAATGAAGAAATCAATACGATGATCTATACGATTGGTGCAGGAGTCGGTCCTGAGTTTTCTATCGAAGACTGTAA
TTACGACAAAGTAATCATCATGACCGATGCGGATACAGACGGCGCCCATATTCAAGTATTACTGCTTACTTTCTTTTATC
GTTATATGAAACCGCTGATTGAAGCTGGGAAAGTATATATCGCGTTACCGCCTTTATATAAAGTATCCAAAGGACAAGGA
AAGAAGCAAGTCATTGAATATGCGTGGACAGATGACGAATTGGCAGCAATGATTAAAAAAGTCGGCAAAGGATATATGCT
GCAGCGATATAAAGGACTTGGAGAGATGAATGCGGAACAATTGTGGGAAACAACGATGGATCCGACTTCCCGTACGTTGA
TCCGCGTCCGTATCGATGATGCTGCGCAAGCTGAACGTCGAGTAACCACACTGATGGGTGACAAAGTAGAACCTCGAAGA
AAATGGATCGAAAATCACGTGCAATTTACGCTCGAAGAAGATGGCAGTATCTTAGATAAAAAAGAGGATACTGAAATCTC
TCCTTCAGTTTCTAATGATTTATTAGATGAAGAACGAGCAGATAAAAATGAAAACAATCAGTTATTTGAAGTAGAATAG

>ACou|CP001138.1|gene3336|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACGCAAACTTATAACGCTGATGCCATTGAGGTACTCACTGGGCTTGAGCCGGTACGCCGCCGCCCGGGGATGTACAC
CGATACGACCCGCCCCAACCATTTGGGTCAGGAAGTGATTGATAATAGTGTGGATGAAGCACTGGCAGGTCATGCCAAAC
GCGTGGATGTCATTTTACATGCCGATCAATCGCTGGAAGTGATTGACGACGGACGCGGGATGCCGGTGGATATCCATCCG
GAAGAGGGGGTTCCGGCGGTAGAACTGATCCTCTGTCGACTTCATGCCGGCGGTAAATTCTCCAATAAGAACTATCAGTT
CTCTGGTGGTCTGCATGGGGTGGGGATTTCGGTAGTGAATGCCCTGTCAAAGCGCGTGGAAGTGACCGTGCGCCGCGACG
GTCAGGTCTATAACATCGCGTTTGAAAACGGCGAAAAAGTGCAGGATTTGCAGGTTGTCGGCACCTGCGGTAAACGTAAT
ACTGGCACCAGCGTGCATTTCTGGCCGGACGAAAGTTTCTTCGACAGCCCGCGTTTTTCTGTCTCTCGCTTAATGCACGT
TCTGAAAGCAAAAGCGGTGCTGTGTCCCGGTGTGGAAATCACTTTTAAAGATGAAGTGAATAACAGCGAGCAGCGCTGGT
GCTACCAGGATGGTCTGAACGACTATCTGGGCGAAGCGGTAAACGGCCTGCCGACGCTGCCGGAAAAGCCGTTTATCGGT
AATTTTAACGGTGAAACGGAAGCGGTTGACTGGGCGCTATTGTGGCTGCCGGAAGGCGGCGAATTACTGACGGAAAGCTA
CGTCAACCTGATCCCGACCATGCAGGGGGGGACGCACGTCAACGGTCTGCGCCAGGGCCTGCTCGACGCGATGCGCGAAT
TTTGCGAATACCGCAATATTCTGCCGCGCGGCGTCAAACTGTCGGCGGAAGATATCTGGGATCGCTGCGCTTATGTGCTT
TCCGTGAAAATGCAGGACCCGCAATTTGCCGGGCAGACCAAAGAGCGTCTGTCGTCGCGTCAATGTGCGGCATTTGTTTC
CGGCGTGGTGAAAGATGCCTTCAGCCTGTGGCTGAACCAGAACGTGCAGGCGGCGGAACAACTGGCAGAGATGGCGATTG
CCAGCGCGCAGCGGCGACTGCGCGCCGCAAAAAAAGTGGTGCGCAAAAAGCTCACCAGCGGTCCGGCGTTGCCGGGGAAA
CTGGCGGACTGTACCGCGCAGGATCTTAATCGGACCGAGCTGTTCCTTGTGGAAGGGGATTCGGCAGGCGGTTCCGCCAA
GCAGGCGCGCGATCGCGAATATCAGGCGATCATGCCGCTCAAAGGTAAGATCCTTAACACCTGGGAAGTCTCTTCCGATG
AAGTGCTTGCCTCGCAAGAGGTGCATGATATTTCCGTGGCGATCGGTATCGATCCGGACAGCGACGATCTGAGTCAGCTG
CGCTACGGCAAGATCTGTATCCTGGCGGATGCGGACTCCGATGGTTTGCATATCGCTACTCTGCTTTGCGCGCTGTTTGT
CAGACATTTCCGCGCGCTGGTGAAGAATGGTCATGTCTATGTCGCGCTACCGCCGCTATACCGTATCGATTTGGGTAAAG
AGGTCTATTACGCGCTGACGGAAGAAGAGAAGGCGGGCGTACTGGAACAACTGAAGCGTAAGAAAGGCAAGCCGAACGTA
CAGCGTTTCAAAGGCCTGGGTGAAATGAACCCGATGCAGTTACGCGAAACCACGCTTGATCCAAATACTCGCCGCCTGGT
GCAGCTCACCATTAGCGATGAAGACGATCAGCGTACTAACGCGATGATGGATATGCTGCTGGCGAAGAAACGTTCTGAAG
ATCGACGCAACTGGCTACAGGAAAAAGGCGATCTCGCGGATCTCGACGTGTAA

>ACou|NC_007793.3913375|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTTCGTATTCCAGAAGAATTATTGCAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAACACTGAAAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTGCAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAAATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|NC_002951.3236245|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTGCATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTTCGTATTCCAGAAGAATTATTGCAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAACACTGAAAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTGCAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAAATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|NC_012469.1.7686068|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
GTGTCAAAAAAGGAAATCAATATTAACAATTATAATGATGATGCTATTCAGGTGCTAGAAGGGTTGGATGCGGTCCGAAA
ACGTCCAGGGATGTATATTGGATCGACCGATGGCGCTGGTCTTCATCACCTAGTTTGGGAAATCGTTGATAATGCAGTCG
ATGAAGCCTTGTCTGGGTTTGGTGATCGTATCGATGTAACCATCAATAAAGACGGTAGTCTAACGGTTCAAGACCATGGA
CGTGGGATGCCGACAGGTATGCACGCTATGGGAATTCCAACTGTTGAGGTTATCTTTACCATTCTTCATGCCGGAGGGAA
ATTCGGTCAAGGTGGCTATAAGACATCAGGTGGACTTCACGGAGTGGGTTCTTCCGTTGTTAACGCCCTTTCTAGCTGGT
TAGAAGTTGAAATTACCCGTGATGGCGCAGTTTACAAGCAACGTTTTGAAAATGGTGGAAAACCTGTCACGACTTTGAAG
AAAATCGGTACAGCACCCAAGTCTAAAACAGGCACCAAAGTTACTTTTATGCCTGACGCGACTATCTTTTCTACGACAGA
TTTCAAGTACAATACCATTTCAGAGCGCCTTAATGAATCAGCCTTTCTCTTGAAAAATGTGACCTTGTCTTTAACGGACA
AGCGAACAGATGAAGCGATTGAGTTCCACTATGAGAATGGAGTACAAGATTTTGTTTCTTATCTCAACGAAGATAAGGAA
ATCTTGACGCCAGTTCTTTACTTTGAAGGGGAAGACAATGGTTTTCAAGTGGAAGTAGCCCTCCAGTACAATGACGGATT
CTCAGATAACATTCTATCCTTTGTCAATAACGTTCGCACCAAGGACGGTGGAACGCACGAGACAGGACTCAAGTCTGCCA
TTACCAAGGTCATGAATGACTATGCACGTAAAACAGGTCTTCTCAAGGAAAAAGATAAAAACCTTGAAGGTTCAGACTAT
CGTGAGGGACTAGCGGCCGTTCTTTCTATCTTAGTTCCTGAAGAACACTTGCAGTTTGAAGGACAGACCAAGGATAAACT
AGGAAGCCCCCTAGCTCGCCCAGTTGTGGATGGAATAGTGGCTGATAAGTTGACCTTTTTCCTTATGGAAAATGGGGAAT
TAGCTTCTAACCTCATCCGCAAGGCTATCAAGGCCCGTGATGCTCGTGAAGCAGCACGTAAGGCGCGTGATGAGAGCCGA
AATGGGAAGAAAAACAAGAAAGATAAGGGCTTGTTGTCTGGGAAATTGACCCCAGCCCAATCTAAGAATCCTGCTAAGAA
TGAACTCTATCTAGTTGAGGGGGACTCTGCCGGTGGTTCTGCCAAACAAGGTCGTGACCGCAAGTTCCAGGCTATTCTAC
CTCTTCGTGGTAAGGTTGTCAATACAGCCAAGGCCAAGATGGCGGATATCCTCAAAAATGAAGAGATCAATACCATGATT
TATACCATTGGTGCGGGTGTTGGAGCAGACTTCTCTATTGAAGATGCCAACTATGATAAGATCATTATCATGACCGATGC
GGATACCGACGGTGCCCATATCCAGACCTTGCTCTTGACATTTTTCTACCGTTACATGCGTCCGCTAGTCGAGGCAGGTC
ATGTCTATATTGCCCTCCCACCTCTTTACAAGATGTCCAAAGGTAAAGGCAAGAAAGAAGAAGTGGCCTACGCTTGGACG
GACGGAGAACTAGAAGAACTCCGTAAACAGTTCGGTAAAGGCGCTACCCTCCAACGATACAAAGGACTTGGTGAGATGAA
TGCGGACCAGCTCTGGGAAACAACCATGAACCCAGAAACACGTACCCTCATCCGTGTCACAATTGAAGATTTAGCGCGCG
CCGAACGCCGCGTCAATGTTCTCATGGGAGATAAGGTAGAACCACGCCGTAAATGGATTGAAGATAATGTCAAGTTTACG
CTAGAAGAAGCGACAGTGTTTTAA

>ACou|CP000675.2|gene802|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGTCAGAAAACTACACTGCGGAAGCGATTGAAGTCTTAAGTGGTCTTGAGCCTGTTCAACGACGTCCCGGTATGTATAC
CGACACGACACGCCCCAACCATTTGGCTCAGGAAGTGATTGATAATAGCGTCGATGAAGTACTTGCTGGATTTGCCAGCC
GTATTATTGTTACTTTACATGAAGACGGCTCTATTGAAGTCGAGGATGATGGCCGAGGTATGCCAGTCGATTTGCATCCT
CAACTGGGCTTAAGTGGTGTCGAGGTCATTATGACTCGACTTCATGCCGGAGGTAAGTTTTCAGATAAAAATTACAGCTT
TTCTGGCGGCTTGCATGGCGTTGGGGTGTCCGTGGTAAATGCCTTGTCAGAACGACTGGACGTCACCATAAAGCGCAATG
GGATCATTTATCAAATGACCTTTGCTAATGGCGACAAATTATGTGAATTAAATGAAACCGGGGTTACAAAAAAAAGAGAG
ACCGGGACTGTTATACGTTTTTGGCCTAATGGCAAATATTTTGACACTACAAAAATTTCTGTAAAACACCTGACTCATGT
ATTAAGAGCAAAAGCGGTATTGTGTAGTGGCTTGTCCATGACCTTTATCAATAAAATCACTAATGAAGAAATGAACTGGT
GTTATGAGCAAGGTTTAACTGATTATTTACAGCAAACCTTGCCCGAAGACTATTTGCCTGAAGAACCTTTTGCCGGAGCA
TTCAAAAGTGATGAAGCAACTGTTGATTGGGCTTTGGCCTGGTCAGACTCTGCCAATGGCAATTTAAATGAAAGTTATGT
GAATTTAATCCCGACAATACAAGGTGGCACGCACGTCAATGGATTGCGTTCGGGATTATTTGAAGCCATGTCTGAATTTT
GTGAGCTGAGAAACCTTCTTCCTCGTGGAGTAAAATTGACAGCGGATGATCTATGGGAATCATGCCAGTATGTTTTATCA
ATCAAAATGAAAGAGCCGCAATTTGCGGGGCAAACCAAAGAGCGCTTGAGTTCACGCCAAACCTCAGGACTAGTCAGTAA
TGTCATAAAAGACGCTTTTGCAATTTGGTTGAATCAGCATCGCAACCAGGGTGAAGCTATAGCAGCTCTCGCAATAGAAC
GCGCACAGAAACGGCTAAAGCAAGCCAAACAAGTGGCACGCAAACGTGTTAGCCAAGGGCCTGCTTTACCTGGAAAATTA
GCCGATTGCTTGCAAACGGACTTAAGTCAAGCGGAACTATTCCTGGTTGAAGGAGATTCGGCAGGAGGGTCGGCCAAACA
AGCCCGCAATAAAGATTATCAAGCCATTTTACCTTTACGTGGAAAAATACTTAATTCATGGGAAGTAGATTCTTCACAAG
TTCTGGCATCCCAGGAAATTCATGATATATCTGTTGCTATAGGTGTAGACCCTGGCTCCAGCGATCTCGAGGGTCTTCGC
TATGGGAAAATCTGTATTCTCGCTGATGCAGACTCTGATGGAGCTCATATTGCCACACTAATATGTGCTTTGTTTTTAAG
ACACTTCAAACCTCTGGTTAAAGCAGGCCATGTTTTTGTAGCCATGCCCCCGCTCTATCGAATCGATGCAGGTAAGCTGA
TTCACTATGCCCTGGATGATGAAGAAAAAAATAGAATCATTCAACATCTCAGTCAAACCACAAAATCAAAAGTGAATGTA
CAGCGATTCAAAGGATTAGGTGAAATGAATCCCATTCAGCTTAGAGAAACCACAATGGACCCCAATACAAGGCGTCTGGT
ACAGCTTACTCTTGATGATGAAGAGCAGACGGAAGCCATTATGGATATGATGCTCAACAAAAAAAGGGCCGCCGACAGAA
AACTCTGGCTAGAAACAAAAGGAAACCTTGCTGAAATTTGA

>ACou|FN543093.2|gene3601|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACCCAATCCTATAATGCCGATGCCATTGAGGTGCTCACCGGGCTTGAGCCGGTGCGCCGCCGTCCGGGGATGTATAC
CGACACCTCCCGTCCCAACCATCTGGGCCAGGAAGTTATTGATAACAGCGTCGATGAAGCGCTGGCCGGGCACGCCAGAC
GCGTCGACGTGATCCTTCACGCCGACCAGTCGCTGGAAGTTATCGACGACGGGCGCGGCATGCCGGTGGATATCCATCCG
GAAGAGGGCGTTCCCGCCGTGGAACTGATCCTCTGCCGTCTGCACGCGGGCGGTAAATTCTCGAACAAAAACTACCAGTT
CTCCGGCGGCCTGCATGGCGTGGGGATCTCTGTGGTTAACGCCCTGTCAAAACGCGTGGAAGTCAACGTGAAACGCGACG
GGCAGATCTACAACATCGCTTTTGAAAATGGCGAAAAGGTGAAAGAGCTGAGCGTGGTCGGCACCTGCCCGAAGCGCCAG
ACCGGCACCAGCGTCCACTTCTGGCCGGATGAAAAATTCTTCGACAGCCCGCGCTTTTCCGTCTCCCGCCTGACGCACCT
GCTGAAAGCGAAAGCGGTACTTTGCCCGGGCGTTGAGATCAACTTTAAAGATCAGGTGAACAACACCGAGCAGCGCTGGT
GCTACCTGGATGGTCTCAACGACTACCTGTGTGAAGCGGTAAACGGGCTGATTACCCTGCCGGAAAAACCGTTTATCGGT
AACTTCTCCGGCGAGACGGAAGCGGTGGACTGGGCGCTGCTGTGGCTGCCGGAAGGCGGCGAGCTGCTAACCGAAAGCTA
CGTTAACCTGATCCCGACCATGCAGGGCGGCACCCACGTCAACGGCCTGCGCCAGGGCCTGCTGGACGCCATGCGTGAGT
TCTGCGAATACCGCAACATCCTGCCGCGCGGCGTGAAGCTCTCGGCGGAAGATATCTGGGAGCGCTGCGCCTATGTCCTG
TCGGTGAAAATGCAGGATCCGCAATTCGCGGGCCAGACTAAAGAGCGCCTGTCGTCACGCCAGTGCGCGGCGTTTGTCTC
AGGCGTGGTGAAAGACGCTTTCAGCCTGTGGCTTAACCAGAACGTCCAGGCGGCGGAACAGCTCGCGGAGCTCGCCATCG
CCAGCGCTCAGCGTCGTCTGCGCGCGGCCAAAAAAGTGGTGCGTAAAAAGCTCACCAGCGGCCCGGCGCTGCCCGGCAAA
CTGGCGGACTGCACCGCGCAGGATCTCAACCGCACAGAGCTTTTCCTGGTGGAAGGGGATTCCGCAGGCGGCTCCGCCAA
ACAGGCGCGCGATCGCGAATATCAGGCGATCATGCCGCTTAAGGGTAAGATCCTGAATACCTGGGAAGTGTCGTCGGATG
AAGTGCTGGCCTCGCAGGAGGTGCACGATATCTCTGTTGCGATCGGCATCGATCCGGACAGCGACGATCTCAGCCAGCTG
CGTTACGGCAAAGTCTGTATCCTCGCGGATGCGGACTCCGACGGTCTGCATATCGCCACGCTGCTGTGCGCGCTGTTTGT
GAAACACTTCCGCTCGCTGGTGAAAGGCGGTCACGTTTACGTTGCCATGCCGCCGCTCTACCGTATCGATCTCGGCAAAG
AGGTCTACTACGCGCTGGACGAAGAAGAAAAAGCGGGCGTGCTGGAACAGCTCAAGCGTAAAAAGGGCAAGCCGAACGTA
CAGCGCTTTAAAGGCCTCGGCGAAATGAACCCGATGCAGCTGCGCGAAACGACGCTGGATCCGAACACCCGCCGCCTGGT
GCAGCTCACCATCAGCGACGACGACGACGCGCGCACGCTGGCGGTGATGGATATGCTGCTCGCCAAAAAACGCTCCGAAG
ACCGCCGTAACTGGCTGCAGGAGAAAGGCGATATGGCGGATATCGAAGTCTGA

>ACou|NC_003098.1.934298|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
GTGTCAAAAAAGGAAATCAATATTAACAATTATAATGATGATGCTATTCAGGTGCTAGAAGGGTTGGATGCGGTCCGAAA
ACGTCCAGGGATGTATATTGGATCGACCGATGGCGCTGGTCTTCATCACCTAGTTTGGGAAATCGTTGATAATGCAGTCG
ATGAAGCCTTGTCTGGGTTTGGTGATCGTATTGATGTAACTATCAATAAAGACGGTAGTCTAACGGTTCAAGACCATGGA
CGTGGGATGCCGACAGGTATGCACGCTATGGGAATTCCAACTGTTGAGGTTATCTTTACCATTCTTCATGCCGGAGGGAA
ATTCGGTCAAGGTGGCTATAAGACATCAGGTGGACTTCACGGAGTGGGTTCTTCCGTTGTTAACGCCCTTTCTAGCTGGT
TAGAAGTTGAAATTACCCGTGATGGCGCAGTTTACAAGCAACGTTTTGAAAATGGTGGAAAACCTGTCACGACTTTGAAG
AAAATCGGTACAGCACTCAAGTCTAAAACAGGCACCAAAGTTACTTTTATGCCTGACGCGACTATCTTTTCTACGACAGA
TTTCAAGTACAATACCATTTCAGAGCGCCTTAATGAATCAGCCTTTCTCTTGAAAAATGTGACCTTGTCTTTAACGGACA
AGCGAACAGATGAAGCGATTGAGTTCCACTATGAGAATGGAGTACAAGATTTTGTTTCTTATCTCAACGAAGATAAGGAA
ATCTTGACGCCAGTTCTTTACTTTGAAGGGGAAGACAATGGTTTTCAAGTGGAAGTAGCCCTCCAGTACAATGACGGATT
CTCAGATAACATTCTATCCTTTGTCAATAACGTTCGCACCAAGGACGGTGGAACGCACGAGACAGGACTCAAGTCTGCCA
TTACCAAGGTCATGAATGACTATGCACGTAAAACAGGTCTTCTCAAGGAAAAAGATAAAAACCTTGAAGGTTCAGACTAT
CGTGAGGGACTAGCGGCCGTTCTTTCTATCTTAGTTCCTGAAGAACACTTGCAGTTTGAAGGACAGACCAAGGATAAACT
AGGAAGCCCCCTAGCTCGCCCAGTTGTGGATGGAATAGTGGCTGATAAGTTGACCTTTTTCCTTATGGAAAATGGGGAAT
TAGCTTCTAACCTCATCCGCAAGGCTATCAAGGCCCGTGATGCTCGTGAAGCAGCACGTAAGGCGCGTGATGAGAGCCGA
AATGGGAAGAAAAACAAGAAAGATAAGGGCTTGTTGTCTGGGAAATTGACCCCAGCCCAATCTAAGAATCCTGCTAAGAA
TGAACTCTATCTAGTTGAGGGGGACTCTGCCGGTGGTTCTGCCAAACAAGGTCGTGACCGCAAGTTCCAGGCTATTCTAC
CTCTTCGTGGTAAGGTTATCAATACAGCCAAGGCCAAGATGGCGGATATCCTCAAAAATGAAGAGATCAATACCATGATT
TATACCATTGGTGCGGGTGTTGGAGCAGACTTCTCTATTGAAGATGCCAACTATGATAAGATCATTATCATGACCGATGC
GGATACCGACGGTGCCCATATCCAGACCTTGCTCTTGACATTTTTCTACCGTTACATGCGTCCGCTAGTCGAGGCAGGTC
ATGTCTATATTGCCCTCCCACCTCTTTACAAGATGTCCAAAGGTAAAGGCAAGAAAGAAGAAGTGGCCTACGCTTGGACG
GACGGAGAACTAGAAGAACTCCGTAAACAGTTCGGTAAAGGCGCTACCCTCCAACGATACAAAGGACTTGGTGAGATGAA
TGCGGACCAGCTCTGGGAAACAACCATGAACCCAGAAACACGTACCCTCATCCGTGTCACAATTGAAGATTTAGCGCGCG
CCGAACGCCGCGTCAATGTTCTCATGGGAGATAAGGTAGAACCACGCCGTAAATGGATTGAAGATAATGTCAAGTTTACG
CTAGAAGAAGCGACAGTGTTTTAA

>ACou|NC_008702.1.4609137|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACGAGCAAGACCTACGACGAATCCTCCTTCCGCGTCCTCAAGGGACTGGAGCCGGTGCGCGAGCGCCCCGGCATGTA
CACCCGCACCGACTCGCCGGCGCACATCATCCAGGAGGTGATCGACAACGCCGCCGACGAGGCGCTCGGCGGCTTCGCGA
AGAAGATCCACGTCACCCTGCACCTCGACGGCTCGGTCACCGTGGCCGACGACGGCCGCGGCATTCCGGTCGGCCTGCAT
CCCGAGGAAGGGGTGCCGGTGGTGGTGCTGGCCTACACCCGGCTGCACGCGGGCGGCAAGTTCGACAAGCGCGAAGGCAA
CGGCGCCTACGCCTTCTCCGGCGGCCTGCACGGCGTCGGTGTGGCGGTGACCAATGCGCTCTCCACCCGTGTCGAGGTCG
AGGTCAAGCGCGACGGCAAGATCCACCGCATCGACTTCAGCGACGGCGGCGAGAACATCGGTGCGGTGCGCATCGAGGGC
GATTGCGGCCGCCAGACCGGCACCCGGGTGCGGGTCTGGCCCGATCCGAAGTACTTCGAGGCGCCGCGCGTGCCGATGAA
CGAACTCGAACGCCTGCTGCGCAGCAAGGCCGTGCTGCTGTCCGGCGTGTCGGTCCGGCTGGATATCGAGCAGGCGGCCG
GTCCGGCGCTGACCAAGACCTGGAGCTACCCGGAAGGCCTCGCCGGCTACCTCAAGGAGCTTGCCGGCGATGTCGAGCCC
GTGGCGCCGATCTTCACCGCCGAAAAGTACGCCGGCAAGGACGACGCCAGCTTCGCCCCCGGCGAAGGCGCGGCCTGGGC
CCTGGCCTGGTTCGAATCCGCGGTGCCGAGCGAATCCTATGTGAACCTGATTCCCACGGTGAATGGCGGCACCCACGAGT
CCGGCCTGCGCGCCGGCGTGTTCGAGGCGGTGAAGTCCTTCATCGAGCACCACACGCTGCTGCCGCGCGGCGTCAAGCTG
CAGCAGGAAGACGTCTGCGGCCGCATGAGCTTCCTGCTCTCGGCCCGCCTGCTCGATCCCCAGTTCCAGGGGCAGGTGAA
GGAAAAACTCAACTCGCGCGAGGCGGTGAAGCTGGTTTCCACCCAGTTGCGCGACCCGTTCGAAATCTGGCTCAACAACC
ACGTCGAGGCCGGCAAGGCCATCGCCGAACTGTCGATCAAGCAGGCGCTGGCGCGGCAGAAGAACGCGCAGAAGGTCGAG
AAGAAAAAGACCTCCGGCGTCGCGGTGCTGCCCGGCAAGCTGTCCGACTGCGAATCCGAGGACATCGCCGAGAACGAACT
CTTCCTGGTCGAGGGCGACTCCGCCGGCGGCTCGGCCAAGATGGCGCGCAACAAGGAGACCCAGGCCATCCTGCCGCTGC
GCGGCAAGGTGCAGAACGCCTGGGAGATCGACCCCGACCGCCTGCTCGCCAACGCCGAGATCCACGACATCGCGGTGGCG
CTCGGTGTCGATGCCCACCGCGCCGACAGCAGCCCGGACCTCTCCGGCCTGCGCTACGGCAAGATCGTCATCATGTCCGA
CGCCGACGTCGACGGCTCGCACATCCAGACCCTGCTGCTCACGCTGTTCTTCCGCCATTTCCCCAAGCTCATCGAGAACG
GCCACATCTACGTCGCGCAGCCGCCGCTGTACCGGGTGGACGTGCCGGCGCAGGGCAAGAAGCGCCCGGCGCGCCGCCTC
TATGCGCTGGACGACGGCGAACTCGCCGCGATCCGCGACCGCCTCGCGCAGGAAGGCTTCAAGCCGGACGCGATCGAGAT
CGGCCGCTTCAAGGGCCTGGGCGAGATGAACCCGGACCAGCTGCGCGAAACCACCATGGACCCCGCCACCCGCCGCGTGC
TGCCGGTGCAGGTGCGCGCGGAAGCCATCGAGCAGACGCTGAAGATGTTCACGCTGCTGATGGGCAAGGGCGAAGCGTCC
GGCCGGCGCGCGTGGATGGAAGAAAAGGGCGATACCGTCGAAGCCGACGTCTGA

>ACou|NC_002745.1124025|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCAATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACC
TGGTATGTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAG
TATTGAATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGT
ATGCCAACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGG
ACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAG
TTGAAATCCATCGAGATGGTAGTATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAA
GGTAAAACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTT
TGATGTTTTAAGCGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTG
GTAAAGAGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTT
TTGCATGACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTC
AGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGA
CACGTGTATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGT
GAAGGTTTAACAGCTGTTGTGTCTGTTCGTATTCCAGAAGAATTATTACAATTTGAAGGACAAACGAAATCTAAATTGGG
TACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGT
CTAAATCACTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCA
GGTAAGAAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAACACTGAAAAAAATGA
ATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCAT
TACGTGGTAAGGTAATTAATACAGAGAAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCAC
ACAATCGGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATTATGACTGATGCTGA
TACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTG
TATTTATTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGAC
GAAGAGCTTAATAAATTGCAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAGATGAACCC
TGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCAT
CTAAACGTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATG
CAAGAGGACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|CP000647.1|gene3444|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACGCAATCTTCATATAATGCTGATGCCATTGAGGTACTCACCGGGCTAGAGCCGGTGCGCCGCCGTCCGGGCATGTA
TACCGACACCACTCGTCCTAACCATCTTGGTCAGGAAGTTATTGATAACAGTGTGGATGAAGCGCTGGCAGGCCACGCCA
AACGCGTGGAAGTTATCCTTCATGCCGACCAGTCCCTGGAGGTCATTGACGATGGTCGTGGGATGCCGGTCGACATCCAC
CCGGAAGAGGGCGTGCCGGCGGTTGAGCTGATCCTCTGCCGGCTGCATGCGGGCGGTAAGTTTTCCAATAAAAACTATCA
GTTTTCCGGCGGCCTGCACGGGGTGGGGATCTCGGTGGTCAACGCCCTGTCAAAACGCGTGGAGGTCAACGTGCGTCGCG
ACGGTCAGGTCTACAGCATCGCCTTTGAAAATGGTGAAAAAGTGGAAGACCTGCACGTCACCGGCACCTGCGGCAAACGC
AATACCGGGACCAGCGTCCATTTCTGGCCGGACGAAAGCTTCTTCGACAGCCCGCGCTTTTCCGTTTCACGTCTGACCCA
CCTGTTAAAAGCGAAAGCGGTGCTGTGCCCGGGCGTGGAAATTGTTTTCCGCGACCAGGTGAACAACAGCGAGCAGAGCT
GGTGCTATGCCGATGGCCTGAACGATTACCTGAGCGAAGCGGTGAACGGCCTGCCGCTGCTGCCGGAAAAACCATTCGTC
GGCGCCTTCTCCGGCGAGACGGAGGCGGTGGACTGGGCGCTGCTGTGGCTGCCGGAAGGCGGCGAGCTGCTGACCGAGAG
CTACGTGAACCTGATCCCGACCATGCAGGGCGGAACGCACGTTAACGGTCTGCGTCAGGGGCTGCTCGACGCGATGCGTG
AGTTCTGCGAGTACCGTAATATCCTGCCGCGCGGCGTGAAGCTGTCAGCGGAAGATATCTGGGATCGCTGCGCGTACGTG
CTGTCGGTGAAGATGCAGGATCCGCAGTTCGCCGGGCAAACCAAAGAGCGTCTGTCGTCGCGCCAGTGCGCGGCGTTCGT
CTCCGGCGTGGTGAAGGACGCCTTCAGCCTGTGGCTGAATCAGAACGTGCAGGCCGCGGAGCTGCTGGCGGAGATGGCCA
TCTCCAGCGCCCAGCGCCGTCTGCGCGCGGCCAAAAAAGTGGTGCGCAAAAAGCTGACCAGCGGTCCGGCGCTGCCGGGT
AAGCTGGCGGACTGTACCGCCCAGGATCTGAACCGTACCGAGCTGTTCCTTGTCGAGGGGGATTCGGCGGGCGGCTCAGC
CAAGCAGGCGCGCGATCGCGAATATCAGGCGATCATGCCGCTGAAGGGCAAGATCCTTAATACCTGGGAAGTCTCTTCCG
ATGAAGTGTTAGCTTCGCAAGAAGTGCACGACATTTCGGTGGCGATTGGTATTGACCCGGATAGCGATGATTTAAGCCAG
CTGCGCTACGGTAAAATTTGTATTCTGGCGGATGCGGACTCCGATGGTCTGCACATTGCCACCCTGCTGTGCGCGCTGTT
CGTAAGACATTTCCGTACCCTCGTGAAAGAGGGGCACGTCTATGTGGCGCTACCGCCGCTGTACCGTATCGACCTCGGTA
AAGAGGTTTACTACGCACTGACGGAAGAAGAAAAAACCGGCGTGCTGGAGCAGCTAAAGCGCAAGAAGGGCAAGCCAAAC
GTCCAGCGCTTTAAAGGGCTCGGTGAGATGAACCCGATGCAGCTGCGCGAAACCACCCTTGACCCGAATACCCGCCGCCT
GGTGCAGCTGGTGATCAGCGATGAGGACGAGCAGCAGACCACGGCGATAATGGATATGCTGCTGGCCAAAAAGCGTTCGG
AAGATCGTCGCAACTGGCTGCAGGAGAAGGGCGATATGGCGGATCTGGAAGTGTAA

>ACou|CP002695.1|gene1273|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCCACACCACGTTACACCGAAGCGTCGATCCGCGTTCTGAAGGGGCTGGAGCCTGTGCGCCAGCGCCCGGGTATGTA
TACCCGCACCGAGAACCCCCTGCACATCGTGCAGGAGGTCATCGACAACGCGGCCGACGAAGCGCTGGCCGGTTACGGCA
AGCAGATTCAAGTCACGCTGCACGGCGACGGCAGCATTTCGGTCGAGGACGACGGACGCGGTATTCCGGTCGGCCTGCAC
CCGGAAGAGAACGCGCCGGTCGTCGAGCTGGTTTTCACGCGCCTGCACGCAGGCGGCAAATTCGACAAGCAGGGCGGCGG
CGCGTATGCGTTCTCCGGCGGCCTGCATGGCGTGGGGGTGTCCGTCACCAACGCGCTGGCCACCCGCCTGGAGGTGGTGG
TGTGGCGCGACGGCGCGGTGCACCGGCTGGTGTTCGCCGGCGGCGACGTGATCGAAGCACTGGCGCCGTACCCCGAGGGC
GGGCGCAAGAAGTCGGGCACCCGCGTGCGGGTATGGCCCGACGCCAAGTATTTCGACAGCCCGGCCATCCCGATGGCCGA
GCTGACCCACCTGCTGCGCAGCAAGGCCGTGCTGCTGCCGGGCGTCAAGGTGTCGCTGGTCAACGAGAAAACCGGCGACA
CGCGCACCTGGCAGTACCAGGAGGGCCTGCGCGGCTACCTGGCCGAGGCGCTGGCCGGCGCCGAGCTGATGATCCCGTTC
TTCGAGGGCCAGCAGTACGCCGGGGCCGACCACGACAGTTTCGCCGAAGGCGAGGGCGCCCAATGGGTGGTGGCTTGGGC
CGAGGACGGCAACGTGGTGCGCGAGTCGTATGTCAACCTGATCCCGACCCCGGCCGGCGGCACCCACGAATCGGGTTTGC
GCGAAGGCCTGTTCGGCGCGGTCAAGGGGTTTGCCGAGCTGCACAGCCTGCTGCCCAAGGGCGTCAAGCTGCTGCCCGAG
GACGTGTTCACGCGCGCCAGCTTCGTGCTGTCGGCCAAGGTGCTGGACCCGCAGTTCCAGGGCCAGATCAAGGAGCGCCT
GAACAGCCGCGACGCCGTGCGCCTGGTGGGCTGCTTCGCCAAGAGCGCCCTGGACCTGTGGCTGCACAGCAATGTCGAAT
ATGGCAAGAAGCTGGCCGAATTGGCCATCCGCCAGGCGCAGGCGCGCCAGCGTTCGGCGCAGAAGGTCGAAAAGCGCAAG
AGCTCGGGCGTGGCCGTGCTGCCCGGCAAGCTGACCGATTGCGAGTCCAGCGACGCCAGCCGCACCGAAGTGTTTCTGGT
CGAGGGCGACTCGGCCGGCGGCTCGGCCAAGATGGGGCGCGACAAGGAGTTCCAGGCCATTCTGCCGCTGCGCGGCAAGG
TGCTCAATTCCTGGGAGGTCGACCGCGACCGGCTGTTCGCCAACAACGAGATCCACGATATTTCGGTGGCGATCGGGGTG
GACCCGCACGGCCCGGGCGATGAGCCCGACCTGTCGGGCCTGCGCTACGGCCGCATCTGCATCCTCTCGGACGCGGACGT
GGACGGCTCGCACATCCAGGTGTTGCTGCTGACGCTGTTCTACCGGCATTTCCCCAAGCTGATCGAGGCCGGCAACGTGT
TCGTGGCCCGGCCGCCGCTGTTCCGGGTGGACGTGCCGGCGCAGGGCAAGCGGCCGGCGCGCAAGATCTACTGCCTGGAC
GCCGGCGAACTGGAGGCCGCGCAGGACAAGCTGCGCAAGGAAGGCGTGCGCGAGTCGGCCTGGAGCGTGAGCCGCTTCAA
GGGCCTGGGCGAAATGAACCCCGAACAGCTGTGGGAGACCACCATGAACCCGGACACCCGCCGGCTGCTGCCGGTCGGCT
ACGGCGACCTGACCCCCGGCGACACCACCCGCATGTTCGACATGCTGATGGGCAAGGGCGAGTCGTCGCAGCGGCGTGCC
TGGATCGAGGAGAAGGGCAACCTGGCGGAGCTGGATATCTGA

>ACou|CP000034.1|gene3210|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACGCAAACTTATAACGCTGATGCCATTGAGGTACTCACCGGGCTTGAGCCGGTTCGCCGCCGTCCGGGGATGTATAC
CGATACCACTCGCCCTAACCATTTGGGGCAAGAAGTTATTGATAACAGTGTCGATGAAGCACTGGCGGGTCACGCAAAAC
GCGTGGATGTAATCTTACATGCTGACCAGTCGTTAGAAGTTATTGACGATGGGCGCGGGATGCCGGTGGATATTCACCCG
GAAGAGGGTGTACCGGCGGTTGAACTGATTCTTTGCCGTCTGCATGCAGGCGGTAAATTCTCTAACAAAAATTACCAGTT
CTCTGGCGGCCTGCATGGCGTGGGGATTTCGGTGGTTAACGCCCTGTCGAAGCGCGTAGAAGTTAACGTGCGCCGCGATG
GTCAGATCTATAACATCGCCTTTGAAAATGGCGAAAAGGTGCAGGATTTACAGGTTGTCGGCACTTGCGGTAAACGCAAT
ACCGGCACCAGCGTCCATTTCTGGCCGGATGAAACCTTCTTCGATAGCCCGCGTTTTTCTGTTTCACGCCTGACGCATGT
GCTGAAAGCCAAAGCAGTACTGTGCCCCGGCGTTGAGATTACCTTTAAAGATGAGATCAACAACACCGAACAGCGCTGGT
GCTATCAGGACGGTCTGAATGATTACCTGGCGGAAGCGGTAAACGGTTTACCGACGCTGCCAGAAAAACCGTTTATCGGT
AATTTCGCTGGTGATACTGAAGCTGTGGACTGGGCGCTACTGTGGCTGCCGGAAGGCGGTGAACTGCTGACCGAAAGCTA
CGTCAACCTTATCCCAACGATGCAGGGCGGTACGCACGTTAACGGTCTGCGTCAGGGCCTGTTGGATGCGATGCGTGAGT
TCTGTGAATACCGCAACATTCTGCCGCGCGGTGTAAAGTTGTCGGCGGAAGATATCTGGGATCGCTGCGCCTATGTTCTG
TCGGTGAAAATGCAGGATCCGCAGTTTGCCGGGCAGACCAAAGAGCGTCTCTCTTCGCGTCAGTGCGCGGCATTCGTTTC
TGGCGTGGTGAAAGATGCCTTTATCCTGTGGCTGAACCAGAACGTTCAGGCGGCGGAGTTGCTGGCAGAGATGGCGATTT
CCAGCGCCCAGCGTCGTATGCGTGCGGCTAAAAAAGTGGTGCGTAAAAAGCTGACCAGCGGTCCGGCGCTGCCTGGCAAA
CTGGCTGACTGTACCGCGCAGGACCTTAACCGCACCGAACTGTTTCTTGTGGAAGGTGACTCCGCAGGCGGCTCTGCCAA
GCAGGCGCGCGATCGCGAATATCAGGCGATCATGCCGCTGAAAGGTAAGATCCTTAACACCTGGGAAGTCTCTTCCGACG
AAGTGCTGGCTTCGCAGGAAGTGCACGATATTTCGGTAGCGATCGGTATCGATCCTGACAGCGACGATTTGAGCCAGCTT
CGTTACGGCAAGATCTGTATCCTGGCGGATGCTGACTCCGATGGTCTGCACATTGCCACGCTGCTCTGCGCTTTGTTTGT
AAAACACTTCCGCGCGTTGGTGAAACACGGTCACGTTTACGTCGCACTGCCACCGCTCTACCGTATTGATCTCGGGAAAG
AGGTTTATTACGCGCTGACGGAAGAAGAGAAAGAGGGCGTACTTGAGCAATTAAAACGCAAGAAAGGCAAGCCGAACGTC
CAGCGTTTTAAAGGTCTGGGGGAAATGAACCCGATGCAATTGCGCGAAACCACGCTTGATCCGAACACTCGCCGTCTGGT
GCAGCTGACTATCGATGATGAAGACGATCAGCGTACTGACGCGATGATGGATATGCTGCTGGCGAAGAAACGCTCGGAAG
ATCGCCGCAATTGGTTGCAAGAGAAAGGCGACATGGCGGAGATTGAGGTTTAA

>ACou|NC_012491.1.7719846|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGAAGGAAACAGAAACACAGCAAACATTAACGTATACGGAAGAAGATATTCAGGTCTTAGAAGGCTTGATTGCTGTTCG
AAAGCGGCCTGGAATGTACATAGGCTCCACGGGCTCGCGTGGCCTGCATCATCTGCTGTGGGAAATTGTAGATAACGCCA
AAGACGAGGCGCTTGCAGGCGTTAATGATAGCATCATCGTCACTTTGTACAAGGATGGCAGTGTCAGCGTAGAGGACCAT
GGACGCGGAATTCCAACGGGTATGCACAAGACTGGCCGACCTGTACCGGAAGTTATTTTTACGACGCTCCATGCCGGTGG
GAAATTCGGCGGTGGCGGATATAAAAAAAGTGGTGGCTTGCACGGGGTAGGCTCCAGTGTCGTTGTGGCTTTGTCCAAAT
GGCTTGAGGTCGAAATCCACCGCGAAGGCAAAATTCATAAGCAGCGCTTTGAATATGTTGTGGATGCAAATGGAACGGAG
CATGTCGGTAAACCGGTTACCGGCCTTGAAATCACGGGGAACACCAAACGCACTGGAACAACGGTACGTTTTCTGCCGGA
TGATGCGGTGTTTGGCAATGCTCGATTTGACTATGAGACGATTCGTGATCGTTTTCGTGAGACGGCATTCCTTCTGAAAA
AGCTGCGCATGGTTCTGATTGACGAACGTGGACCTGAAAAGAAACGGGAAGAGTTTTACTTCGAAGATGGCTTGAAATCA
TACGTTTCTTACTTGAACGAAGGAAAAAATTCACTCCATCCGATCGTTTACTTCGAAGGAGAAAAGGACAATATCTATGT
GGAGCTGGCTTTTCAGTACAATGACGGCTATGCAGAGACATTGGTGTCCTATGTCAACTCGATTGTAACAACGGATGGCG
GAACACATGTCACAGGCTTCCGTAACGGTACGACCCGGATTTTTAACGAATTTGCCCGGAAAAAAGGGTACTTGAAAGAA
AAGGACCCGAACTTGACTGGAAACGATTTGCGGGAAGGTTTCCTCGGTGTATTGTCATTGCAAATGGCTGACGTCCAGTT
TGAGTCCCAAACAAAAGACAAGCTGGGGAACGAAGAAGCACGGGCAATCGTAGAACAGATTGTTTCCGAAAAGCTAGGCT
TCTTCCTCGAGGAAAATCCGGAAATAGGCAAGCTGCTGATTGACAAGGCAGTGCGTTCTGCTGAAATTCGCGAAGAGCTA
CGCAAACAACGCGAAGCCCTGCGCGGCGACAAGAAAGGCAAAACCGCGAAAAAGCGCAAATCGATTTCGGAAAAGTTCAC
TCCGCCGCAATACAGAGACTCCAAACGCAATGAGCTCTTCCTCGTCGAGGGGGATTCCGCAGGTGGCTCTGCAAAGCAGG
CGCGTAATTCAGAGTTCCAAGCTTTGTTCAGCCTGCGTGGGAAGCCGTTGAACACGGAAAAAGCAAAGCTATCCGAGGTA
TTGGCGAATGAAGAGTTCCGTACGATCCTCGAGGTGCTTGAAACCGATATTGGCGAAGAGTTTTCCATCGAAAACTGTGC
ATTTGATAAAGTCATCATCATGTCTGACGCGGACGTTGACGGCTCGCACATTCAAACGCTGCTCTTGACCTTCTTCTTCC
GCTACATGCGCCCGATGATTGCAGCTGGTCACTTGTATATTGCGCAACCGCCTTTGTATCAGGTGAAAAAGCAAAGCAAG
GGTAAGCAGACTGAGGCGATCTACTGTTGGAGTGATTACGAGCTGGAACAGGCGTTGAAAAAGGTTGGACGCGGTGCTGA
AGTGCAGCGCTACAAAGGATTGGGTGAGATGAACGCCGATCAGCTCTGGGAAACAACCATGGACCCTGAGACGCGCAAGC
TCATTAAGGTTGAACTGGAAGACCTCGCTCACTGTGAGAAGCTGGTAACCGTTTTGATGGGTGATAAAGTCCCACCACGG
CGTGAGTGGATTGAGAACCACGTCACCTTTGAAGTGGGGGAGGATGAGTAA

>ACou|NC_010410.6000336|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
GTGACACAATATACGGCTCAATCGCTTGAAGTTCTTTCCGGTTTAGACCCTGTTCGTCGTCGTCCGGGGATGTATACCGA
TACTTCTCGTCCTAACCATTTAGCCCAAGAAGTTATTGATAATGCTGTCGATGAAGCCTTAGCCGGTCATGCCGACAAAA
TCTGTGTCACGGTTTATAAAGATGGTTCATTGTCAGTTGAAGATAATGGCCGTGGTATGCCAGTCGATATTCACCCTGAA
TATGGCCAAAGTGGTATCGAAATCATTTTAACCAAGCTGCATGCTGGTGGTAAGTTTAGTACCGATAACTATCAGTTTTC
AGGTGGTTTACATGGTGTGGGGATTTCGGTTGTAAATGCTTTATCAACTCGTGTTGAGGTAGAAGTTCAGCGTCAGGGTA
ATTTATACCAGATGGCCTTTGAGCAAGGTGAACCTGTTGCGCCTTTGGCAGTGCTAGAAGGCAAAGCACCAAAACGTGCG
ACTGGTACAACGGTACGTTTCTGGCCTGAAGCTAAATATTTTGATAGTCCAAAATTTGCGTTAAAAGCACTCAAACATAA
TTTAAAAGCCAAAGCTGTTTTAGCAGCTGGTTTAAAAATTACTTATATCGATCAAATTAATGATGAAAAAATCGAATGGC
AATTTGAAAATGGCCTTGTCGATTATTTGATGGATGAATTACAAGATCGTGAAATTTTGCCAAACCCTGCATTTGTAAGC
AGTGGCCAAGCAGACCGTGCAGCATGTGAATTTGCGATTTGCTGGAATGTAGAAGGTGGTGAACAGGTTCAAGAAAGTTA
TGTCAACCTGATTCCAACTGCACAAGGTGGTACTCATGTGAACGGTTTGCGTTCGGGGGTGACCGAAGCGCTACGTGAAT
TCTGTGAGTTACGCAATTTATTACCACGTAATCTTAAACTTTCGGCTGAAGATGTTTGGGATGGCGTGAACTATATTTTA
TCGCTTAAGTTCCAAGAACCACAGTTCTCTGGTCAAACCAAAGAGCGTCTTTCAAGTCGTGAAGCTGCCAATATTGTTTT
AAACATTGCTAAAGATGCGTTTGCGCTCTGGCTCAACCAGCATGCTGAAATTGCCATGCAACTTGCTGAAATGGCAATTT
CTAAAGCAGGGCGCCGTTTAAAAGCTGCAAAAAAAGTTGAGCGTAAAAAGATTGTTTCTGGCCCGGCTTTACCGGGTAAG
CTGGCGGACTGCGTGGGCCAAACACGTGAAGAAAGTGAACTCTTTATTGTCGAGGGTGACTCTGCGGGCGGTAGTGCCAA
GCAGGCGCGTGATAAGAACTTTCAAGCTATCATGCCAATTCGTGGAAAAATCTTAAATACATGGGAAGTTTCTTCAGATG
AAGTACTTGCTTCTCAGGAAGTTCACGACATTGCCATTGCAATTGGTGTAGACCCGGGTAGTGATGATTTATCTGAATTA
CGTTACGGCAAAATCTGTATTTTGGCCGATGCCGACTCGGATGGTTTACACATTGCGACTTTGCTTTGCGCTTTATTCGT
TAAACATTTTCCAGCATTGGTTGAAGAAGGGCATTTGTATGTAGCAATGCCACCATTGTTCCGTATCGACATTGGTAAAG
ATGTTCATTACGCGCTAGATGATGAAGAGCTTGAAACCATTTTGAAAAATGTTAAAGGCAATAAGAACCCGCAAATTACC
CGATTCAAAGGGTTGGGTGAGATGAACGCAATTCAACTACGTGAAACAACAATGGATCCGAACACCCGTCGTTTGGTGCA
ACTCGATCTAGATGATGCACATTTAACGGCAGGTTTACTCGACAAGCTCCTTGCAAAAAAACGTGCAGCAGACCGTAAGC
AATGGCTTGAGCAGAAGGGTAACTTAGCTGATATTACGGTTTAA

>ACou|NC_002516.2.879897|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGGCTACTTACAACGCAGACGCCATCGAAGTCCTTTCCGGCCTCGACCCGGTGCGCAAGCGCCCGGGGATGTACACCGA
CACCACCCGCCCCAACCATCTGGCCCAGGAAGTCATCGACAACAGCGTCGACGAAGCCCTGGCCGGCCATGCGAAGAGCG
TGCAGGTGATCCTGCACCAGGACAACTCGCTGGAAGTCATCGACGATGGCCGCGGCATGCCGGTGGACATCCACCCGGAA
GAGGGCGTGCCGGGCGTCGAGCTGATCCTTACCAAGCTGCATGCCGGCGGCAAGTTCTCGAACAAGAACTACCAGTTCTC
CGGCGGCTTGCACGGGGTCGGCATCTCGGTGGTGAACGCGCTCTCGACCCGGGTCGAGGTACGCGTCAAGCGCGACGCCA
ACGAGTACCGGATGACCTTCGCCGACGGCTTCAAGGACAGCGATCTGGAAGTCATCGGCACGGTCGGCAAGCGCAATACC
GGTACCAGCGTGCATTTCTGGCCGGATCCGAAGTATTTCGATTCGGCGAAGTTCTCGGTCAGCCGCCTCAAGCATGTGCT
CAAGGCCAAGGCGGTGCTGTGCCCGGGCCTGAGCGTGGTGTTCGAGGACAAGAACACCGGCGAGCGCGTCGAGTGGCACT
TCGAGGACGGCCTGCGCTCCTACCTGACCGACGCGGTCGCCGAGCTGCCGCGCCTGCCCGATGAACCCTTCTGCGGCAAC
CTCGAAGGTTCCAAGGAAGCGGTGAGCTGGGCCCTGCTGTGGCTGCCCGAGGGCGGTGAGTCGGTGCAGGAAAGCTACGT
CAACCTGATTCCCACGGCCCAGGGCGGCACCCATGTGAACGGCCTGCGCCAGGGCCTGCTCGACGCCATGCGCGAGTTCT
GCGAGTTCCGCAACCTGTTGCCGCGCGGCGTCAAGCTGGCGCCCGAGGACGTCTGGGAGCGGATCGCCTTCGTCCTCTCG
ATGAAGATGCAGGAGCCGCAGTTCTCCGGGCAGACCAAGGAGCGCCTGTCGTCCCGCGAGGCGGCGGCGTTCGTCTCGGG
CGTGGTGAAGGACGCCTTCAGCCTGTGGCTCAACGAGCACGCCGAAATCGGCCTGCAACTGGCGGAACTGGCGATCAGCA
ACGCCGGGCGTCGCCTCAAGGCGGGCAAGAAGGTCGAGCGCAAGAAGATCACCCAGGGGCCGGCGCTGCCCGGCAAACTG
GCCGACTGCGCCGGACAGGAACCGATGCGCGCGGAACTGTTCCTGGTCGAGGGCGACTCCGCCGGCGGCTCGGCGAAGCA
GGCGCGGGACAAGGAATTCCAGGCGATCATGCCGCTGCGCGGAAAGATCCTGAACACCTGGGAAGTGGACGGCGGCGAGG
TGCTCGCCAGCCAGGAGGTCCACGACATCGCGGTGGCCATCGGCGTCGATCCGGGTGCCAGTGACCTGGCCCAGCTGCGC
TACGGCAAGATCTGTATCCTCGCGGATGCCGACTCCGACGGGCTGCACATCGCCACGCTGCTCTGCGCGCTGTTCGTCCG
CCATTTCCGCCCGCTGGTGGAAGCCGGCCACGTCTACGTGGCGATGCCGCCGCTGTACCGCATCGACCTCGGCAAGGACA
TCTACTACGCCCTCGACGAAGCCGAGCGCGACGGCATCCTCGAGCGCCTGGCCGCAGAGAAGAAGCGCGGCAAGCCGCAG
GTCACCCGCTTCAAGGGCCTTGGCGAAATGAATCCGTTGCAACTGCGCGAGACCACCATGGATCCGAATACCCGGCGGCT
GGTCCAGCTCACCCTGGAGGACGCCACCGGTACCCTGGAGATCATGGACATGCTGCTGGCCAAGAAGCGCGCCGGTGACC
GCAAGTCCTGGCTGGAAAGCAAGGGCAACCTGGCCGAGGTGCTGGTCTGA

>ACou|NC_007795.3920057|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCAGTTCGTAAAAGACCTGGTAT
GTATATTGGATCAACTGATAAACGGGGATTACATCATCTAGTATATGAAATTGTCGATAACTCCGTCGATGAAGTATTGA
ATGGTTACGGTAACGAAATAGATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGTATGCCA
ACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCAGGAGGTAAATTTGGACAAGG
CGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCTTCAGTTGTAAATGCATTGAGTGAATGGCTTGAAGTTGAAA
TCCATCGAGATGGTAATATATATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAAGGTAAA
ACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCTACATCATTTAATTTTGATGT
TTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAAAATTTAAAAATAACGCTTAATGATTTACGCAGTGGTAAAG
AGCGTCAAGAGCATTACCATTATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTTTTGCAT
GACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATATAATGATCAATATTCAGAAAG
TATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGTGGTACACATGAAGTTGGTTTTAAAACAGCAATGACACGTG
TATTTAATGATTATGCACGTCGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGTGAAGGT
TTAACAGCTGTTGTGTCTGTTCGTATTCCAGAAGAATTATTGCAATTTGAAGGACAAACGAAATCTAAATTGGGTACTTC
TGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAATTGCCATTCTATTTAGAAGAAAAAGGACAATTGTCTAAAT
CACTTGTGAAAAAAGCGATTAAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCAGGTAAG
AAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAACACTGAAAAAAATGAATTGTA
TTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTTGGACGAGACCGCAAATTCCAAGCGATATTACCATTACGTG
GTAAGGTAATTAATACAGAGAAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCACACAATC
GGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATTATGACTGATGCTGATACTGA
TGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTCAAATATATGAAACCGCTTGTTCAAGCAGGTCGTGTATTTA
TTGCTTTACCTCCACTTTATAAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGACGAAGAG
CTTAATAAATTGCAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTGGGTGAAATGAACCCTGAACA
ATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTAATTCGTGTACAAGTTGAAGATGAAGTGCGTTCATCTAAAC
GTGTAACAACATTAATGGGTGACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATGCAAGAG
GACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAGGAGGAAATCTAG

>ACou|NC_010400.5986295|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
GTGACACAATATACGGCTCAATCGCTTGAAGTTCTTTCCGGTTTAGACCCTGTTCGTCGTCGTCCGGGGATGTATACCGA
TACTTCTCGTCCTAACCATTTAGCCCAAGAAGTTATTGATAATGCTGTCGATGAAGCCTTAGCCGGTCATGCCGACAAAA
TCTGTGTCACGGTTTATAAAGATGGTTCGTTGTCGGTTGAAGATAATGGCCGTGGTATGCCAGTCGATATTCACCCTGAA
TATGGACAAAGTGGTATCGAAATCATTTTAACCAAGCTGCATGCTGGCGGTAAGTTTAGTACTGATAACTATCAGTTTTC
AGGTGGTTTACATGGTGTGGGGATTTCGGTTGTAAACGCTTTATCTACACGTGTTGAAGTAGAAGTTCAGCGTCAGGGTA
ATTTATACCAGATGGCATTTGAGCAAGGTGAACCTGTTGCTCCTTTAGCGGTGTTAGAAGGTAAAGCACCTAAACGCGCG
ACAGGAACTACGGTACGTTTCTGGCCTGAAGCCAAATATTTTGATAGTCCAAAATTTGCTTTAAAAGCACTCAAACATAA
TTTAAAAGCCAAAGCTGTTTTAGCTGCTGGTTTAAAAATCACTTATATCGATCAAATTAATGATGAAAAAATCGAATGGC
AATTTGAAAATGGCCTTGTCGATTATTTGATGGATGAATTGCAAGACCGCGAAATTTTGCCAAACCCTGCATTTGTAAGC
AGTGGGCAAGCAGACCGTGCGGCATGTGAATTTGCGATTTGCTGGAATGTAGAGGGTGGCGAACAGGTTCAAGAAAGTTA
TGTCAACCTGATTCCAACTGCACAAGGTGGTACTCATGTGAACGGTTTGCGTTCGGGGGTGACTGAAGCGCTACGTGAAT
TCTGTGAGTTACGTAATTTATTACCACGTAATCTTAAACTTTCGGCTGAAGATGTTTGGGATGGCGTGAACTATATTTTA
TCGCTTAAGTTCCAAGAACCACAGTTCTCTGGTCAAACCAAAGAGCGTCTTTCGAGTCGTGAAGCTGCCAATATAGTTTT
AAATATTGCTAAAGATGCGTTTGCGCTCTGGCTCAACCAACATGCTGAAATTGCCATGCAACTTGCTGAAATGGTAATTT
CTAAAGCAGGGCGCCGTTTAAAAGCTGCAAAAAAAGTTGAGCGTAAAAAGATTGTTTCTGGCCCGGCTTTACCGGGTAAG
CTGGCGGACTGCGTGGGCCAAACACGGGAAGAAAGTGAACTCTTTATTGTCGAGGGTGACTCAGCGGGCGGTAGTGCCAA
GCAGGCGCGTGATAAGAACTTTCAGGCCATCATGCCAATTCGTGGAAAAATCTTAAATACATGGGAAGTTTCTTCAGATG
AAGTACTTGCTTCTCAGGAAGTTCACGATATTGCCATTGCAATTGGTGTAGACCCGGGTAGTGATGATTTATCTGAATTA
CGTTACGGCAAAATCTGTATTTTGGCCGATGCCGACTCGGACGGTTTACACATTGCGACTTTGCTTTGCGCTTTATTCGT
TAAACATTTTCCAGCATTGGTTGAAGAAGGGCATTTGTATGTAGCAATGCCACCATTGTTCCGTATCGATATTGGTAAAG
ATGTTCATTACGCGCTAGATGATGAAGAGCTTGAAACCATTTTGAAAAATGTTAAAGGTAATAAGAACCCGCAAATTACC
CGATTCAAAGGGTTGGGTGAGATGAACGCAATTCAACTACGTGAAACAACAATGGATCCGAACACCCGTCGTTTGGTTCA
GCTTGATCTAGATGATGCACATTTAACGGCAGGTTTACTCGACAAGCTCCTTGCAAAAAAACGTGCAGCAGATCGTAAGC
AGTGGCTTGAGCAGAAGGGTAACTTAGCTGATATCACTGTTTAA

>ACou|CP001581.1|gene3049|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGGAGGAAAGAATAGATAACACGAAGGATTATGATGTTACCAAGTTAACCTCTTTGGAAAAATTAGAGCCTGTAAGAGT
AAGACCAGGAATGTATATAGGATCTACTGGGATAAAAGGTCTTCATCACTGTATTTGGGAGATATTAGATAATGCTATTG
ATGAAATTTCAAATGGATATGGAGATACTGCAGAAGTTATATTAAATAAAGATAAAAGCGTTACAGTTGTGGATAATGGA
AGAGGAATTCCTACAGGTATACATCCTATAAAAAAGAAGTCTGGTGTGGAAATGGTTTTTACAGAGCTTCATACAGGAGG
AAAATTTAATAATTCAATATATAAAACTTCTGGAGGACTGCATGGGGTTGGAGCATCAGTAGTTAATGCTTTATCTGAGT
GGACAGAGGTTGAAGTTTATCAGAATGATAAAATATATAAACAAAGATTTGAATATGCCTTAGATAAAAAACTAAATAAA
AAAATGCCAGGAACTCCTGTAACAAAACTTAAAATAGTAGGAGATACAGACAAAACTGGTACTAGAGTAACATTTAAACC
TGATAAAGAAGTATTTTCAACTATAGATTTTAAATTCGATGTTATAGATGAAAGACTACAAGAGTTAGCCTTTCAAAATA
AAGGGATAATTTTAAAACTTATAGACAATAGAAAAGAAGAGCCGGAAATAAAAGAATATCATTCTGAAAGAGGTCTTTTA
GACTTTATAGATTATTTAAATGAAAGTAAAGCACCAATACATAATCCAGCAGTATTATTTGAGGGAGAAAAGGAAATAAA
TAATTTAAAAATGGAAGGAGAAATATGCTTCCAATTTACAGACTCTTCAACAGAAAATATAGCAAGTTATGTAAATAATA
TTCCAACCACAGAAGCTGGAACCCATGAAACTGGATTTAAAACAGGTATGACTAGAGCTTTTAAAGAAGGAGCAAAAAAG
TTAAGCCTTATAAAAGAAAAAGATAAAGAATTTGATGGCGATGATCTTAGAGAAGGAATTACAGCTATAGTTAGAATAAA
AATAAGTAATCCTGTGTTTGAAGGTCAAACTAAAACTAAGCTTGGAAATAATGAAGCTTATACTATGATGAATGATTTAG
CCTATAGTAAATTTTTAGAATGGATAGAAGATAATAAAGAAGTATCCACATTGATTATAAATAATGCATTAGCTGCTGCA
GCTAGAAGAGAAAAAATAAAAAAAATAAATGAAGCAGAAAAGAAAAAAATAGGTAAAGGATTAGCACCGTTAGCAGGAAA
AATAGCTGTGTGTACTTTAAGAGATTCAAATGTAACAGAGTTTATAGTGGTAGAAGGAGATTCTGCGGGAGGTTCTGCAA
AACAAGCAAGAGATAGAAGATTTCAAAGCATAATGCCTTCTAAGGGTAAAATAATGAATACAGAAAAACAAAAAATCGAA
AATGTATTAGGCAGTGAAGAATTAAAAATATTTAATACAGCTATAGGTACAGGTGTATTAGATAATTATAAAGAGGAAGA
CTTAAAATATGATAAGATAATAATATTAAGTGATGCGGATGTAGATGGATATCATATTAGAACTTTATGGATGACTTATA
TATATAGATATATGAAGTCTTTAGTAGCTAATGGTCATCTTTATATAGCTATGCCACCTTTGTATAAAGTTTACAAGAAA
GATAAGAAAGGCGAAAAGTCGGTTTATTGCTATAATGATGAAGAATTACAAAAGGCTAAAAAACAAATTGGAAGGGGATA
CCTAATTCAAAGATATAAAGGATTAGGAGAAATGAATCCAGAACAATTATGGGAAACTACATTAAATCCTGAGACAAGAA
CACTTCAAAGAATAACTATAGAAGATGCCGCAAAAGCTGAAAAGATGGTATCTTTGCTTATGGGAGATGTAGTAGAACCT
AGAAAAAATTACTTATACAAATATGCAGAGTTTTAG

>ACou|NC_009725.1.5460263|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
TTGGCTAGAAAACAGCAATTTGATTACAACGAAGATGCCATACAGGTGCTTGAAGGCCTGGAAGCCGTCAGAAAACGACC
GGGAATGTACATCGGTTCGACGGACGCACGCGGCCTGCACCATCTGGTATATGAGATCGTCGACAATTCCGTCGATGAAG
TTCTTGCCGGCTACGGAGATCATATTATCGTAACGATACATAAGGACAACAGCATCTCCGTACAGGACAGAGGACGCGGA
ATGCCGACCGGGATGCATAAGCTCGGAAAGCCGACGCCGGAAGTTATTTTCACCGTGCTGCATGCCGGGGGGAAATTCGG
ACAGGGCGGCTATAAAACAAGCGGCGGTCTGCATGGTGTCGGTGCATCTGTCGTAAACGCATTATCGGAGTGGCTGACGG
TTACTATTGAGCGTGACGGATATGTGTATAAACAGCGGTTTGAAAACGGCGGCAAGCCCGTGACTTCACTTGAAAAAATC
GGAACGACCAAAAAAACAGGAACGCTTACCCATTTTAAACCTGATCCGTCAATGTTCAGCGCAACGGTTTATAATTTTGA
CACGCTGTCAGAACGTCTGCGCGAATCGGCTTTCTTGTTAAAAGGTTTGAAAATAGAATTAATTGATGAACGGAACGGCG
TAAAAGAAGTATTTTATTATGAGAACGGAATTGAAGCGTTTGTCGCTTATCTAAACGAGGAAAAAGACGCTTTATGCGAA
GTGGTTTCCTTTGAAGGCGAGCATCATGACATTGAAGTCGATTTCGCGTTTCAGTTTAATGACGGGTATTCAGAAAATAT
GCTGTCATTCGTTAATAACGTCAGAACAAAGGACGGCGGCACCCACGAATCAGGAGCCAAAACGGCAATGACAAGAGCGT
TTAACGAGTATGCGCGAAAGGTCGCCCTTTTAAAAGAGAAAGACAAGAACCTTGAAGGCGCCGATATCAGGGAAGGTTTG
TCCGCAATCATTTCCGTGCGTATCCCGGAGGAACTGCTGCAATTTGAAGGCCAGACGAAAGGGAAGCTTGGCACAAGTGA
GGCGAGATCCGCCGCGGATGCCGTCATTTCCGAGAATCTTGCTTATTTCCTGGAAGAAAACCGCGATACAGCAACCCTGC
TTGTCAAAAAAGCGATTAAAGCAAGCCAGGCCCGTGAAGCGGCCCGAAAAGCGAGAGAAGAAGCGAGAAGCGGCAAAAAG
CGCAAAAAATCAGAAGCGACGCTGAGCGGAAAACTCACACCGGCCGGTTCCAGAAATCCGGCGAAGAATGAATTGTATCT
GGTGGAGGGAGACTCTGCGGGAGGTTCTGCAAAACAGGGAAGAGACCGGAAATTCCAAGCCGTGCTGCCCCTTCGCGGAA
AGGTCATCAACACAGAGAAAGCAAAGCTTGCAGACATCTTCAAAAATGAAGAAATCAATACGATTATTCATGCGATCGGA
GGCGGTGTCGGCGCAGATTTTGAGATAGACGACATCAATTATGACAAGATCATCATCATGACGGACGCGGATACCGACGG
CGCGCACATTCAAGTCTTGCTGTTAACATTTTTCTACCGCTATATGAAACCTTTAATCGAGCACGGAAAAGTCTTCATCG
CCCTTCCGCCTCTTTACAAAGTGAGCAAAGGAAGCGGTAAGAAAGAGATTATTGAATATGCTTGGTCCGACGAAGAAATG
GACGGCGTTTTAAAGAAAGTCGGCAAAGGGTATACCATCCAGCGCTATAAAGGGTTGGGAGAAATGAACGCAGACCAGCT
CTGGGAAACGACGATGAATCCCGAATCGCGAACGCTCGTCAGAGTCAAGATCGACGATGCGGCACGGGTAGAACGCCGTG
TAACGACATTAATGGGAGACAAAGTAGAACCGAGAAGAAAATGGATTGAAAAAAATGTTGCCTTCGGATTAGATGAGGAA
AGCAATATTTTAGAAAATGAAAACTTGTCGGTCGCTGAGGAGGTTTAA

>ACou|CP004022.1|gene2481|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
ATGACTCAATCAAGTTATAATGCAAAGGATATTGAGGTTCTTAATGGTCTAGAGCCTGTACGTCGGCGTCCTGGTATGTA
TACCGATACCACTAGACCGAACCATTTGGCACAGGAAGTGATAGATAATAGCGTGGACGAGGCGCTTGCGGGGCATGCAA
CCAAGGTCGAAGTTATCTTATATGCAGACCAATCTATTGAGGTTATCGACAATGGGCGAGGAATGCCGGTTGATATCCAT
CCAGAACTGAAAGTCTCTGCTATTGAGCTGATCCTTGCCCATCTTCATGCCGGAGGAAAATTCTCCAATAAAAACTACCA
ATACTCTGGTGGCTTGCATGGTGTCGGGATCTCAGTGGTTAATGCGTTATCAAAGCGTATTGAAGTCACCGTGCGCCGAG
AAGGCAAAATATATCAAATTGCTTTTGAGAACGGTGATAAAGTTGAAGAGCTACATCAAATAGGTACGTGTGCTAAACGA
GATACAGGAACCAGTGTTCATTTCTGGCCGGATAGCACTTACTTTGATATTCCTCGTTTCTCATCAAAAAGCTTATCTCA
TGTATTAAAAGCCAAAGCGGTGTTGTGCCCAGGCGTCAATGTCTCTTTTACCGATAAAGTCAATAATACCCAAGAAACGT
GGTGTTACGCTGATGGTTTAACTGACTATTTAAGTGAAGCTGTCGCTGAATTTGTTCGCCTGCCTGAAGAGCCATTTACA
GGGAAATTTGAAGGTGATAACGAAGCCGTTGAATGGTCAATGCTTTGGTTGCCGGAAGGAGGCGATTTACTCACAGAAAG
TTATGTGAACCTCATTCCAACCGTACAAGGTGGTACACACGTTAATGGTTTGCGCCAAGGTGTATTAGATGCCATGCGCG
AGTTTTGTGAATTCCATAATTTATTGCCAAGAGGCATTAAATTAACCGCAGATGATACATGGGAGCGTTGTGCTTATGTG
TTATCAGTAAAAATGCAAGATCCTCAATTTGCAGGACAAACCAAAGAGCGTCTATCGTCACGTCAAACCAGTGCCTTTGT
TGCTAGTGCAGTAAAAAATGCATTTAGTTTATGGTTAAACCAAAACGTTCAAGTCGGTGAATTACTCGCAGAAATGGCTA
TTAGCAGTGCGCAACGACGTATGCGTGCGGCTAAAAAAGTGGTGAGAAAAAAACTGACTTCGGGGCCTGCATTGCCGGGT
AAATTAGCAGATTGTACTTCGCAAGATTTACGTTATACCGAACTCTTCTTAGTTGAAGGGGACTCTGCGGGGGGCTCTGC
TAAACAAGCTCGCGATCGTGAATATCAAGCGATTATGCCTCTACGTGGTAAAATTCTTAATACTTGGGAAGTCTCTTCTG
ATGAAGTATTAGCGTCACAAGAAGTGCATGATATTTCTGTGGCGATCGGGATGGATCCTGATAGTGATGATTTAAGCCAA
TTACGTTACGGAAAAATTTGTATCCTTGCGGATGCGGACTCCGATGGTTTACATATCGCCACTTTGCTTTGTGCTTTATT
TGTTCGTCATTTCCCGGCATTAGTAAAGCAAGGTCATGTCTATATGGCTATGCCACCTCTTTATCGTATCGACTTAGGTA
AAGAAGTGAGTTATGCCCTTGATGAAGCAGAAAAGAACGCTATTTTGCAACGCCTTAGCCGTAAAAAAGGTAAGCCAAAT
GTGCAACGCTTTAAAGGCTTAGGTGAGATGAATCCACTGCAATTACGTGAGACAACGCTTGATCCTAATACACGTCGTTT
AGTGCAATTGGTGATTGATGATGAAAATTATCAAGAAACGTTGGGCATGATGGATATGTTACTTGCCAAAAAACGTTCTG
AAGATCGCCGTAACTGGTTGCAAGAAAAAGGCGACGAAGTTGACATCGAAGTGTAA

>ACou|NC_010611.6235284|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|PARE|RequiresSNPConfirmation
GTGACACAATATACGGCTCAATCGCTTGAAGTTCTTTCCGGTTTAGACCCTGTTCGTCGTCGCCCGGGGATGTATACCGA
TACTTCTCGTCCTAACCATTTAGCCCAAGAAGTTATTGATAATGCTGTCGATGAAGCCTTAGCCGGTCATGCCGACAAAA
TCTGTGTCACGGTTTATAAAGATGGTTCATTGTCAGTTGAAGATAATGGCCGTGGTATGCCAGTCGATATTCACCCTGAA
TATGGCCAAAGTGGTATCGAAATCATTTTAACCAAGCTGCATGCTGGTGGTAAGTTTAGTACTGATAACTATCAGTTTTC
AGGTGGTTTACATGGTGTGGGGATTTCGGTTGTAAATGCTTTATCTACACGTGTTGAAGTAGAAGTTCAGCGTCAGGGTA
ATTTATACCAGATGGCATTTGAGCAAGGTGAACCTGTTGCTCCTTTAGCGGTGTTAGAAGGTAAAGCACCTAAACGTGCG
ACAGGAACTACGGTACGTTTCTGGCCTGAAGCCAAATATTTTGATAGCCCAAAATTTGCTTTAAAAGCACTCAAACATAA
TTTAAAAGCCAAAGCTGTTTTAGCTGCTGGTTTAAAAATCACTTATATCGATCAAATTAATGATGAAAAAATCGAATGGC
AATTTGAAAATGGCCTTGTCGATTATTTGATGGATGAATTGCAAGACCGTGAAATTCTACCAAACCCTGCATTTGTAAGC
AGTGGGCAAGCAGACCGTGCTGCGTGTGAATTTGCGATTTGCTGGAATGTAGAAGGTGGTGAACAGGTTCAAGAAAGTTA
TGTCAACCTGATTCCAACTGCACAAGGTGGTACTCATGTGAACGGTTTGCGTTCAGGGGTGACCGAAGCGCTACGTGAAT
TCTGTGAGTTACGTAATTTATTACCACGTAATCTTAAACTTTCGGCTGAAGATGTTTGGGATGGCGTGAACTATATTTTA
TCGCTTAAGTTCCAAGAACCCCAGTTCTCTGGTCAAACCAAAGAGCGTCTTTCAAGTCGTGAAGCTGCCAATATAGTTTT
AAACATTGCTAAAGATGCGTTTGCGCTCTGGCTCAACCAGCATGCTGAAATTGCCATGCAACTTGCTGAAATGGCAATTT
CTAAAGCAGGGCGCCGTTTAAAAGCTGCAAAAAAAGTTGAGCGTAAAAAGATTGTTTCTGGCCCAGCTTTACCGGGTAAG
TTGGCAGACTGCGTGGGCCAAACACGTGAAGAAAGTGAACTCTTTATTGTTGAGGGTGACTCAGCGGGCGGTAGTGCCAA
GCAGGCGCGTGATAAGAACTTTCAAGCCATCATGCCAATTCGTGGAAAAATCTTAAATACATGGGAAGTTTCTTCAGATG
AAGTACTTGCTTCTTCTCAGGAAGTTCACGACATTGCCATTGCAATTGGTGTAGACCCGGGTAGTGATGATTTATCTGAA
TTACGTTACGGCAAAATCTGTATTTTGGCCGATGCCGATTCGGATGGTTTACACATTGCGACTTTGCTTTGTGCTTTATT
CGTTAAACATTTTCCAGCATTGGTTGAAGAAGGGCATTTGTATGTAGCAATGCCACCATTGTTCCGTATCGACATTGGTA
AAGATGTCCATTACGCGCTAGATGATGAAGAGCTTGAAACCATTTTGAAAAATGTTAAAGGCAATAAGAACCCGCAAATT
ACCCGATTCAAAGGGTTGGGCGAGATGAACGCAATTCAACTACGTGAAACAACAATGGATCCGAACACCCGTCGTTTGGT
TCAGCTTGATCTAGATGATGCACATTTAACGGCAGGTTTACTCGACAAGCTCCTTGCAAAAAAACGTGCAGCAGACCGTA
AGCAATGGCTTGAGCAGAAGGGCAACTTAGCTGATATTACTGTTTAA