MEGAResFrom MEG, the Microbial Ecology Group

GYRBA

The GYRBA group of genes confer resistance to Aminocoumarins through the mechanism, Aminocoumarin-resistant DNA topoisomerases.

References

    Other Groups in Aminocoumarin-resistant DNA topoisomerases

    Sequences

    Download Sequences

    >>MEG_3244|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    ATGTCGAATTCTTATGACTCCTCCAGTATCAAAGTCCTGAAAGGGCTGGATGCGGTGCGTAAGCGCCCGGGTATGTATAT
    CGGCGACACGGATGACGGCACCGGTCTGCACCACATGGTATTCGAGGTGGTAGATAACGCTATCGACGAAGCGCTCGCGG
    GTCACTGTAAAGAAATTATCGTCACCATTCACGCCGATAACTCTGTCTCTGTACAGGATGACGGGCGCGGCATTCCGACC
    GGTATTCACCCGGAAGAGGGCGTATCGGCGGCGGAAGTGATCATGACCGTTCTGCACGCAGGCGGTAAATTTGACGATAA
    CTCCTATAAAGTGTCCGGCGGTCTGCACGGCGTTGGTGTTTCGGTAGTAAACGCCCTGTCGCAAAAACTGGAGCTGGTTA
    TCCAGCGCGAGGGTAAAATTCACCGTCAGATCTACGAACACGGTGTACCGCAGGCCCCGCTGGCGGTTACCGGCGAGACT
    GAAAAAACCGGCACCATGGTGCGTTTCTGGCCCAGCCTCGAAACCTTCACCAATGTGACCGAGTTCGAATATGAAATTCT
    GGCGAAACGTCTGCGTGAGTTGTCGTTCCTCAACTCCGGCGTTTCCATTCGTCTGCGCGACAAGCGCGACGGCAAAGAAG
    ACCACTTCCACTATGAAGGCGGCATCAAGGCGTTCGTTGAATATCTGAACAAGAACAAAACGCCGATCCACCCGAATATC
    TTCTACTTCTCCACTGAAAAAGACGGTATTGGCGTCGAAGTGGCGTTGCAGTGGAACGATGGCTTCCAGGAAAACATCTA
    CTGCTTTACCAACAACATTCCGCAGCGTGACGGCGGTACTCACCTGGCAGGCTTCCGTGCGGCGATGACCCGTACCCTGA
    ACGCCTACATGGACAAAGAAGGCTACAGCAAAAAAGCCAAAGTCAGCGCCACCGGTGACGATGCGCGTGAAGGCCTGATT
    GCGGTCGTTTCCGTGAAAGTGCCGGACCCGAAATTCTCCTCCCAGACCAAAGACAAACTGGTTTCTTCTGAGGTGAAATC
    GGCGGTTGAACAGCAGATGAACGAACTGCTGGCAGAATACCTGCTGGAAAACCCAACCGACGCGAAAATCGTGGTTGGCA
    AAATTATCGATGCTGCCCGTGCCCGTGAAGCGGCGCGTCGCGCGCGTGAAATGACCCGCCGTAAAGGTGCGCTCGACTTA
    GCGGGCCTGCCGGGCAAACTGGCAGACTGCCAGGAACGCGATCCGGCGCTTTCCGAACTGTACCTGGTGGAAGGGGACTC
    CGCGGGCGGCTCTGCGAAGCAGGGGCGTAACCGCAAGAACCAGGCGATTCTGCCGCTGAAGGGTAAAATCCTCAACGTCG
    AGAAAGCGCGCTTCGATAAGATGCTCTCTTCTCAGGAAGTGGCGACGCTTATCACCGCGCTTGGCTGTGGTATCGGTCGT
    GACGAGTACAACCCGGACAAACTGCGTTATCACAGCATCATCATCATGACCGATGCGGACGTCGACGGCTCGCACATTCG
    TACGCTGCTGTTGACCTTCTTCTATCGTCAGATGCCGGAAATCGTTGAACGCGGTCACGTCTACATCGCTCAGCCGCCGC
    TGTACAAAGTGAAGAAAGGCAAGCAGGAACAGTACATTAAAGACGACGAAGCGATGGATCAGTACCAGATCTCTATCGCG
    CTGGACGGCGCAACGCTGCACACCAACGCCAGTGCACCGGCATTGGCTGGCGAAGCGTTAGAGAAACTGGTATCTGAGTA
    CAACGCGACGCAGAAAATGATCAATCGTATGGAGCGTCGTTATCCGAAAGCAATGCTGAAAGAGCTTATCTATCAGCCGA
    CGTTGACGGAAGCTGACCTTTCTGATGAGCAGACCGTTACCCGCTGGGTGAACGCGCTGGTCAGCGAACTGAACGACAAA
    GAACAGCACGGCAGCCAGTGGAAGTTTGATGTTCACACCAATGCTGAGCAAAACCTGTTCGAGCCGATTGTTCGCGTGCG
    TACCCACGGTGTGGATACTGACTATCCGCTGGATCACGAGTTTATCACCGGTGGCGAATATCGTCGTATCTGCACGCTGG
    GTGAGAAACTGCGTGGCTTGCTGGAAGAAGATGCGTTTATCGAACGTGGCGAGCGTCGTCAGCCGGTAGCCAGCTTCGAG
    CAGGCGCTGGACTGGCTGGTGAAAGAGTCCCGTCGCGGCCTCTCCATCCAGCGTTATAAAGGTCTGGGCGAGATGAACCC
    GGAACAGCTGTGGGAAACCACTATGGACCCGGAAAGTCGTCGTATGCTGCGCGTTACCGTTAAAGATGCGATTGCTGCCG
    ACCAGTTGTTCACCACGCTGATGGGCGACGCCGTTGAACCGCGCCGTGCGTTTATTGAAGAGAACGCCCTGAAAGCGGCG
    AATATCGATATTTAA

    >>MEG_3245|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    GTGACTGCATTGTCAGATGTAAACAACACGGATAATTATGGTGCTGGGCAAATACAAGTATTAGAAGGTTTAGAAGCAGT
    ACGTAAAAGACCAGGTATGTATATAGGATCGACTTCAGAGAGAGGTTTGCACCATTTAGTGTGGGAAATTGTCGATAATA
    GTATCGATGAAGCATTAGCTGGTTATGCAAATCAAATTGAAGTTGTTATTGAAAAAGATAACTGGATTAAAGTAACGGAT
    AACGGACGTGGTATCCCAGTTGATATTCAAGAAAAAATGGGACGTCCAGCTGTCGAAGTTATTTTAACTGTTTTACATGC
    TGGTGGTAAATTCGGCGGTGGCGGATACAAAGTATCTGGTGGTTTACATGGTGTTGGTTCATCAGTTGTAAACGCATTGT
    CACAAGACTTAGAAGTATATGTACACAGAAATGAGACTATATATCATCAAGCATATAAAAAAGGTGTACCTCAATTTGAC
    TTAAAAGAAGTTGGCACAACTGATAAGACAGGTACTGTCATTCGTTTTAAAGCAGATGGAGAAATCTTCACAGAGACAAC
    TGTATACAACTATGAAACATTACAGCAACGTATTAGAGAGCTTGCTTTCTTAAACAAAGGAATTCAAATCACATTAAGAG
    ATGAACGTGATGAAGAAAACGTTAGAGAAGACTCCTATCACTATGAGGGCGGTATTAAATCTTATGTTGAGTTATTGAAC
    GAAAATAAAGAACCTATTCATGATGAGCCGATTTATATTCATCAATCTAAAGATGATATTGAAGTAGAAATTGCGATTCA
    ATATAACTCAGGATATGCCACAAATCTTTTAACTTACGCAAATAACATTCATACGTACGAAGGTGGTACGCATGAAGACG
    GATTCAAACGTGCATTAACGCGTGTCTTAAATAGTTATGGTTTAAGTAGCAAGATTATGAAAGAAGACAAAGATAGACTT
    TCTGGTGAAGATACACGTGAAGGTATGACAGCAATTATATCTATCAAACATGGTGATCCTCAATTCGAAGGTCAAACGAA
    GACAAAATTAGGTAATTCTGAAGTGCGTCAAGTTGTAGATAAATTATTCTCAGAGCACTTTGAACGATTTTTATATGAAA
    ATCCACAAGTCGCACGTACAGTGGTTGAAAAAGGTATTATGGCGGCACGTGCACGTGTTGCTGCGAAAAAAGCGCGTGAA
    GTAACACGTCGTAAATCAGCGTTAGATGTAGCAAGTCTTCCAGGTAAATTAGCCGATTGCTCTAGTAAAAGTCCTGAAGA
    ATGTGAGATTTTCTTAGTCGAAGGGGACTCTGCCGGGGGGTCTACAAAATCTGGTCGTGACTCTAGAACGCAGGCGATTT
    TACCATTACGAGGTAAGATATTAAATGTTGAAAAGGCACGATTAGATAGAATTTTGAATAACAATGAAATTCGTCAAATG
    ATCACAGCATTTGGTACAGGAATCGGTGGCGACTTTGATCTAGCGAAAGCAAGATATCACAAAATCGTCATTATGACTGA
    TGCCGATGTGGATGGAGCGCATATTAGAACATTGTTATTAACATTCTTCTATCGATTTATGAGACCGTTAATTGAAGCAG
    GCTATGTGTATATTGCACAGCCACCGTTGTATAAACTGACACAAGGTAAACAAAAGTATTATGTATACAATGATAGGGAA
    CTTGATAAACTTAAATCTGAATTGAATCCAACACCAAAATGGTCTATTGCACGATACAAAGGTCTTGGAGAAATGAATGC
    AGATCAATTATGGGAAACAACAATGAACCCTGAGCACCGCGCTCTTTTACAAGTAAAACTTGAAGATGCGATTGAAGCGG
    ACCAAACATTTGAAATGTTAATGGGTGACGTTGTAGAAAACCGTAGACAATTTATAGAAGATAATGCAGTTTATGCAAAC
    TTAGACTTCTAA

    >>MEG_3246|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    ATGAGTGATGAAACAACCTCACCGACATCTGGTGACTATGGTGCCGCTTCTATCAAGGTTCTCAAAGGTCTTGATGCTGT
    CCGTAAACGTCCTGGTATGTACATCGGTGATACCGACGACGGTTCAGGCTTACACCATATGGTTTATGAAGTCGTCGACA
    ACGCTATTGATGAAGCATTAGCTGGCTACGCAACTCTTGTAAATGTTACGCTCCATGCCGATGGATCCTGTTCTGTTTGT
    GATAATGGACGTGGAATTCCAACTGATATTCACCCAACAGAACATGTATCAGCTGCTGAAGTGATCATGACGCAACTTCA
    TGCTGGTGGAAAATTTGATCAAAATTCTTATAAAGTTTCAGGGGGATTACACGGCGTTGGTGTCTCTGTTGTTAATGCAC
    TATCGGTTTGGTTGCGCCTTCGAATCAAGCGTGATGGTAAAATCCATGAAATGTCGTTTACTCATGGAGTGGCTGATGCT
    CCGCTCAAAGTCGTTGGTCAATGCGGTACAGAAAGTGGCACAGAAATCAGCTTTTTACCAAGCCCCGAAACCTTCACCAT
    GGTTAAATTTGATTTCGAAACATTAGAGCGTCGTCTTAGAGAATTAGCTTTTTTGAATTCTGGTGTACACATTCTTCTTG
    TTAACCAACACCATGCTGATGTTCGATCAGTAGAATTATATTACGAAGGTGGATTAATTGAATTTATCAAATATATTGAC
    CAATCAAAAAAACCCTTAATTGATGCACCGATTTACATCACAAGCGAAAAAGATGGGATCAGTGTAGATGTTGCTTTATG
    GTGGAACGATTCTTATCATGAGAAAGTATTGTGTTTCACCAATAATATTCCTCAACGCGATGGAGGAACCCATTTAGCGG
    GATTCCGCAGCGCCTTAACACGTCAAATTAACGGTTATGCTGAATCCTCAGGCATTGCAAAAAAAGAAAAAGTTAATTTA
    ACTGGCGATGATTGCCGTGAAGGACTCACAGCCATTCTTTCCGTTAAAGTTCCCGATCCAAAATTTTCTTCACAGACAAA
    GGATAAATTGGTTTCTTCTGAAGTCCGTCCAATTGTTGAAAATTTGGTAAATGAAGGACTTTCAGCATGGCTAGAAGAAC
    ACCCTAATGAAGCAAAAATTCTCATTAGCAAAGTTGTAGAAGCTGCTGCAGCGCGCGAAGCAGCACGCAAAGCGCGTGAA
    CTTACACGGCGAAAAGGAGCTCTCGATATCACTTCTTTACCAGGTAAACTTGCTGATTGTCAGGAACGTGATCCTACAAA
    ATCAGAAATTTTTATCGTCGAGGGGGATTCAGCTGGTGGTTCAGCTAAAAGCGGACGTTCACGCCAAAATCAAGCAATTT
    TGCCTTTACGCGGTAAAATTCTTAATGTCGAACGAGCACGTTTCGACCGAATGCTTTCATCCGAAATGATTGGTACGCTT
    ATTACTGCCCTTGGAACCTCTATTGGTAAGGATGAATTTTCACCTGATAAATTGCGTTATCACAAAATCATCATTATGAC
    AGATGCAGATGTTGATGGCGCTCATATTCGCACCTTGCTTCTCACTTTCTTTTTCAGACAAATGCCTGAATTAATTGAAC
    GTGGTCATCTTTATATCGCGCAACCACCTCTTTATAAAGTATCACGTGGTAAATCCTCTCAGTACATTAAAAATGAAGCA
    GCATTTGAAGATTTCTTAATTGATAGTGGTTTGGAAGAAACAACATTAGAATTATCAAGTGGTGAGGTTTGTGCAGGCAT
    TGATTTACGCCAATTCGTCCAAGATGCCCGTTTGTTGCGCCAACTCTTAAACGGTCTCCATACCCGCTATGACCGCAATA
    TTGTTGAGCAAGCAGCAATCGCTGGTGCTTTCAATTTTGAGGCTTTTGCAACACCAGAAACAGCACAAAAAATAGCGGAT
    ACGATAGCAAAACGTCTTGATTTAATTGCTGATGATATGGAACGTGGTTGGAGCGGTCAATATACATCAGATGGAAGTTT
    ATGCTTTGAACGCGTTTTGCGCGGAGTTAAAGATGTTATTACTCTTGATGCAGGGTTTATAAATTCAGCAGATGCACGCC
    AAATTGGTCATATTGCCAAAAATCTCAAAGACATCTATCGTGATCCTCCTCTTTTGCGTCGCAAAGATAAGTCAGAACGC
    ATTTTTGGTCCTACGAGTTTATTGGAAAGTATTTTTATAAACGGTAAAAAAGGTATTACTTTACAGCGTTACAAAGGCCT
    TGGAGAAATGAATGCTGATCAGCTTTGGGAAACAACTCTTGATCCTGATGCGCGTTCTCTTTTACAAGTTAAAATCAATG
    ACGCAACTGATGCAGATTCTCTCTTCTCCCAGTTAATGGGTGATGAAGTTGAACCACGGCGAATTTTTATTCAAAAAAAT
    GCCCTAAACGTTGCTAATCTTGATATCTAA

    >>MEG_3247|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    GTGACCACTTACGACACTCGCACCGCCACCGATACCCCCGGATCCCAGCAGCCCGGCCACGTGGGGGCGGCGTCGTATGA
    CGCCAACGCGATCACTGTTCTGGACGGCCTGGACGCCGTACGCAAGCGGCCCGGGATGTACATCGGCTCGACGGGAGAGC
    GGGGGCTCCATCACCTGGTGCAGGAGCTCGTGGACAACTCCGTGGACGAGGCACTCGCGGGGGTGGCTGACCGGATCGAC
    GTGACGATCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAATGGCCGCGGCATCCCGGTGGGGACGCACCCGGTGGAGAA
    GCGGCCGGCCGTCGAGGTGGTGCTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTATGCGGTCTCCGGCG
    GTCTGCACGGTGTGGGTCTGTCGGTGGTCAACGCCCTGTCGACCCGGCTTTCGGCGGAGATCTGGACCGACGGCTACCGG
    TGGACGCAGGACTACAGGGACGGCGCTCCCACCGCTCCGCTGGCCCGCCACGAGGCCACCTCCAGGACAGGCACCTCGCT
    GACGTTCTGGGCAGACGGCGACATCTTCGAGACCACCGAATACTCCTTCGAGACGCTGGCCAGGCGTTTCCAGGAGATGG
    CCTTCCTCAACCGCGGGCTCACCCTGACGCTCACGGACGAACGGCCCTCCGCGCGCGCGACGGCCGCGGCCGACGAGGCC
    GACTCGGACCCGGCAGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGCCTACCTCAATTCCCG
    CAAGGGCGAACCGGCCCATCCCTCGGTCATCACTATCGCCGCAGAGGACACGGAACGGCTGCTGTCGGCCGAGGTCGCCC
    TGCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCCTACGCCAACGGGATCCACACCCATGAGGGCGGCACCCATGAG
    GAGGGCTTCCGTACGGCCCTGACCACCGTGGTCAACCGCTACGCGCGGGAGAAGAAGCTGCTGCGGGAGAAGGACGCGAA
    CCTCTCCGGCGAGGACGTCCGCGAGGGCCTGACCGCGATCATCTCGGTCAAGCTCGGCGAGCCGCAGTTCGAGGGCCAGA
    CGAAGACCAAACTCGGCAACACCGAGGCGCGCACCTTCGTTCAGAAGATCGTCCACGAGCATCTGACCGACTGGTTCGAC
    CGCAACCCGAACGAGGCCGCGGACATCGTGCGCAAGGCCATCCAGGCGGCCACGGCCCGGGTCGCGGCCCGCAAGGCGCG
    CGACCTGACCCGCCGCAAGGGCCTGCTGGAAACGGCGGCGCTACCGGGCAAGCTGTCCGACTGTCAGTCGAACGACCCGG
    CGATGTCGGAGATCTTCGTCGTTGAAGGAGACTCCGCCGGCGGCTCGGCCAAGTCCGGCCGCAACCCGCAGTACCAGGCG
    ATCCTCCCGATCCGCGGCAAGATCCTCAACGTGGAGAAGGCCCGGATCGACAAAATTCTGCACAACCAGGAGATCCAGGC
    GCTCATCTCCGCGTTCGGCACGGGCGTGCACGAGGACTTCGACATCGCCAAGCTCCGCTACCACAAGATCATTTTGATGG
    CGGACGCCGATGTCGACGGCCAGCACATCAACACCCTGCTGCTGACCTTCCTGTTCCGCTTCATGCGGCCACTGGTCGAG
    GAGGGTCACGTCTACCTCTCCCGCCCCCCGCTGTACAA

    >>MEG_3248|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    GTGACCACTTACGACACTCGCACCGCCACCGATACCCCCGGATCCCAGCAGCCCGGCCACGTGGGGGCGGCGTCGTATGA
    CGCCAACGCGATCACTGTTCTGGACGGCCTGGACGCCGTACGCAAGCGGCCCGGGATGTACATCGGCTCGACGGGAGAGC
    GGGGGCTCCATCACCTGGTGCAGGAGCTCGTGGACAACTCCGTGGACGAGGCACTCGCGGGGGTGGCTGACCGGATCGAC
    GTGACGATCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAATGGCCGCGGCATCCCGGTGGGGACGCACCCGGTGGAGAA
    GCGGCCGGCCGTCGAGGTGGTGCTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTATGCGGTCTCCGGCG
    GTCTGCACGGTGTGGGTCTGTCGGTGGTCAACGCCCTGTCGACCCGGCTTTCGGCGGAGATCTGGACCGACGGCTACCGG
    TGGACGCAGGACTACAGGGACGGCGCTCCCACCGCTCCGCTGGCCCGCCACGAGGCCACCTCCAGGACAGGCACCTCGCT
    GACGTTCTGGGCAGACGGCGACATCTTCGAGACCACCGAATACTCCTTCGAGACGCTGGCCAGGCGTTTCCAGGAGATGG
    CCTTCCTCAACCGCGGGCTCACCCTGACGCTCACGGACGAACGGCCCTCCGCGCGCGCGACGGCCGCGGCCGACGAGGCC
    GACTCGGACCCGGCAGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGCCTACCTCAATTCCCG
    CAAGGGCGAACCGGCCCATCCCTCGGTCATCACTATCGCCGCAGAGGACACGGAACGGCTGCTGTCGGCCGAGGTCGCCC
    TGCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCCTACGCCAACGGGATCCACACCCATGAGGGCGGCACCCATGAG
    GAGGGCTTCCGTACGGCCCTGACCACCGTGGTCAACCGCTACGCGCGGGAGAAGAAGCTGCTGCGGGAGAAGGACGCGAA
    CCTCTCCGGCGAGGACGTCCGCGAGGGCCTGACCGCGATCATCTCGGTCAAGCTCGGCGAGCCGCAGTTCGAGGGCCAGA
    CGAAGACCAAACTCGGCAACACCGAGGCGCGCACCTTCGTTCAGAAGATCGTCCACGAGCATCTGACCGACTGGTTCGAC
    CGCAACCCGAACGAGGCCGCGGACATCGTGCGCAAGGCCATCCAGGCGGCCACGGCCCGGGTCGCGGCCCGCAAGGCGCG
    CGACCTGACCCGCCGCAAGGGCCTGCTGGAAACGGCGGCGCTACCGGGCAAGCTGTCCGACTGTCAGTCGAACGACCCGG
    CGATGTCGGAGATCTTCGTCGTTGAAGGAGACTCCGCCGGCGGCTCGGCCAAGTCCGGCCGCAACCCGCAGTACCAGGCG
    ATCCTCCCGATCCGCGGCAAGATCCTCAACGTGGAGAAGGCCCGGATCGACAAAATTCTGCACAACCAGGAGATCCAGGC
    GCTCATCTCCGCGTTCGGCACGGGCGTGCACGAGGACTTCGACATCGCCAAGCTCCGCTACCACAAGATCATTTTGATGG
    CGGACGCCGATGTCGACGGCCAGCACATCAACACCCTGCTGCTGACCTTCCTGTTCCGCTTCATGCGGCCACTGGTCGAG
    GAGGGTCACGTCTACCTCTCCCGCCCCCCGCTGTACAAGATCAAGTGGGGCCGGGACCACGTCGAATACGCCTACTCCGA
    TCGCGAACGCGACGTGCTCCTGGAACGGGGCCGGCAGGACGGCCGCCGGATCAAGGACGACTCCATCCAGCGCTTCAAGG
    GCCTGGGCGAGATGAACGCCGAGGAACTGCGCGTCACCACCATGGACCCCGACCACCGGGTCCTGGGCCAGGTCACCCTC
    GATGACGCGGCCGTCGCCGACGATCTCTTCTCCGTCCTGATGGGTGAGGACGTCGAAGCCCGCCGCCACTTCATCCAGCG
    CAACGCCAAGGACGTCCGCTTCCTCGACATCTGA

    >>MEG_3249|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    GTGACTACTTACGACACTCGCACCGCCACCGACACCCGCGGATCCGAGCAGCCCGGCCACGTGGGGACGGCGTCGTATGA
    CGCCAACGCGATCACCGTTCTGGACGGCCTGGACGCCGTACGCAAACGGCCCGGGATGTACATCGGCTCTACCGGGGAGC
    GGGGGCTCCATCACCTGGTGCAGGAGCTCGTGGACAACTCCGTGGACGAGGCACTCGCGGGGGTGGCCGACCGGATCGAC
    GTGACGGTCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAACGGCCGCGGCATCCCGGTGGGGATGCACCCGGTGGAGAA
    GCGGCCGGCCGTCGAGGTGGTGCTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTACGCGGTCTCCGGCG
    GTCTGCACGGTGTGGGTCTGTCGGTGGTCAACGCCCTGTCGACCCGGCTGTCGGCGGAGATCTGGACCGACGGCCACCGG
    TGGACGCAGGACTACAGGGACGGCGCTCCCACCGCCCCACTGGCCCGCCACGAGGCCACCTCCCGGACGGGCACCTCGCT
    GACGTTCTGGGCGGACGGCGACATCTTCGAGACCACCGAATACTCCTTCGAGACGCTGGCCAGGCGTCATCAGGAAATGG
    CCTTCCTCAATGGTGGGCTCACCCTGACCCTCACCGACGAACGGTCCTCCGCGCGCGCGACGGCCGCGGTCGACGAAGCC
    GACTCGGACCCGACGGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGTCCACCTCAATGCCCG
    CAAGGGCGAGCCGGCCCATCCCTCGGTCATCACCATCGCCGCCGAGGACACGGAACGGCTGTTGTCGGCCGAGATCGCCC
    TGCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCCTACGCCAACGCGATCCACACCCATGAGGGCGGCACCCACGAG
    GAGGGCTTCCGCACGGCACTGACCACCGTGGTCAACCGCTACGCGCGGGAGAAGAGGCTGCTGCGGGACAAGGACGCGAA
    CCTCTCCGGCGAGGACATCCGCGAGGGTTTGACCGCGATCATCTCGGTCAAGCTCGGCGAACCGCAGTTCGAGGGCCAGA
    CCAAGACCAAACTCGGCAACACCGAGGTGCGCACCTTCGTTCAGAAGATCGTCCACGAGCACCTGGCCGACTGGTTCGAC
    CGCAACCCGAACGAGGCCGTGGACATCGTGCGCAAGGCCGTCCAGGCCGCCACGGCCCGGGTCGCGGCCCGCAAGGCGCG
    CGACCTGACCCGCCGCAAGGGCCTGCTGGAAACGGCGGCGCTGCCGGGCAAGCTGTCCGACTGCCAGTCGAACGACCCGG
    CGACGTCAGAGATCTTCATCGTCGAAGGAGACTCCGCCGGCGGCTCTGCCAAAGCCGGCCGCAATCCGCAGTACCAGGCG
    ATCCTCCCGATCCGCGGCAAAATCCTGAACGTCGAGAAGGCGCGGATCGACAAAGTACTGCAGAACCAGGAGATCCAGGC
    GCTCATCTCCGCGTTCGGCACGGGTGTGCACGAGGACTTCGACATCGCCAAGCTCCGTTACCACAAAATCATTCTGATGG
    CGGACGCGGACGTCGACGGCCAGCACATCAGCACCCTGCTGCTGACCTTCCTCTTCCGCTTCATGCGGCCACTGGTCGAG
    GAGGGGCACGTCCACCTCTCCCGACCGCCGCTGTACAAGATCAAGTGGAGTCGGGAACACGTCGAATACGCCTACTCCGA
    CCGCGAACGCAACACACTCCTGGAACGGGGCCGCCGGGACGGCCGCCGGATCAGGGACGACTCCATCCAGCGCTTCAAGG
    GTCTGGGCGAGATGAACGCCGAGGAACTGCGCGTCACCACCATGGACCCCGACCACCGGGTCCTGGGACAGGTCACCCTC
    GACGACGCGGCTTTCGCCGACGACCTCTTCTCCGTCCTGATGGGCGAGGACGTGGAAGCCCGCCGCCACTTCATCCAGCG
    CAACGCCCAGGACGTCCGCTTCCTCGACATCTGA

    >>MEG_3250|Drugs|Aminocoumarins|Aminocoumarin-resistant_DNA_topoisomerases|GYRBA|RequiresSNPConfirmation
    GTGACTTCTTACGACACCCGCACCGCCACCGACACCCCCGGACCCCAACTGCCCGGCCAGGTGGGGACGGCGTCGTACGA
    CGCCGACGCGATCACCGTGCTGGACGGCCTGGACGCCGTACGCAAGCGGCCCGGGATGTACATCGGCTCCACGGGGGAGC
    GGGGGCTCCATCACCTGGTGCAGGAACTCGTGGACAACTCGGTGGACGAGGCACTCGCGGGGGTGGCCGACCGGATCGAC
    GTGACGGTCCTGGCCGACGGCGGGGTGCGGGTGGTCGACAACGGCCGCGGCATCCCGGTGGGGATGCACCCGGTGGAGAA
    GCGGCCGGCCGTCGAGGTCGTACTGACCGTGCTGCACGCGGGCGGGAAGTTCGGGGGCGGCGGGTACACGGTCTCCGGCG
    GACTGCACGGCGTGGGTCTGTCGGTGGTCAACGCCCTGTCGGCCAGGCTGTCGGCGGAGATCTGGACGGACGGCCACCGC
    TGGACGCAGGACTACCGGGACGGCGCTCCCACCGCCCCACTGGTCCGCCGGGAGGCCACCTCCCGCACGGGCACCTCACT
    GACCTTCTGGGCGGACGGCTCCATCTTCGAGACCACCGACTACTCCTTCGAGACGCTGGCCAGGCGTTTCCAGGAGATGG
    CCTTCCTCAACCGTGGGCTCACGCTGACCCTCACCGACGAACGGGCCTCCGCGCGCGCCACGGCCGCGACCGACGAGGTC
    CACCCGGACCCGGCGGCGAAGACGGTCTCCTACCGCTACGACGGCGGCATCACCGACTTCGTCGCGTATCTCAACTCCCG
    CAAGGGCGAACCGGTCCATCCCTCGGTCGTCACCATCGCCGCCGACGACACGGAGCGGCTGCTGTCGGCCGAGATCGCGC
    TCCAGTGGAACGGCCAGTACACCGACAGCGTGTACTCGTACGCCAACGCGATCCACACCCACGAGGGCGGCACCCACGAG
    GAGGGCTTCCGTACGGCCCTGACCACCGTGGTCAACCGCTACGCGCGGGACAAGAAGCTGCTGCGGGAGAAGGACGCGAA
    CCTCGCCGGCGAGGACATCCGTGAGGGGCTGACCGCGATCATCTCGGTCAAGCTCAGAGAACCGCAGTTCGAGGGCCAGA
    CCAAGACCAAACTCGGCAACACGGAGGTGCGCACCTTCGTCCAGAAGGTCGTCCACGAGCATCTGACCGACTGGTTCGAC
    CGCAACCCGAACGAGGCCGCGGACATCGTGCGCAAGGCCGTTCAGGCCGCCACGGCCCGGGTCGCGGCCCGTAAGGCGCG
    GGATCTGACCCGCCGTAAGGGCCTGCTGGAGACGGCGTCGCTGCCGGGCAAGCTGTCGGACTGTCAGTCGAACGACCCGG
    CGATGTCGGAGATCTTCATCGTCGAGGGAGACTCCGCCGGCGGCTCGGCCAAATCCGGCCGCAATCCGCAGTACCAGGCG
    ATCCTCCCGATCCGGGGGAAGATCCTCAATGTCGAGAAGGCGCGGATCGACAGGATTTTGCAGAACCAGGAGATCCAGGC
    GCTCATCTCCGCGTTCGGCACGGGTATGCACGAGGACTTCGACATCGCCAAGCTCCGCTACCACAAGGTCATCTTGATGG
    CGGACGCCGACGTCGACGGCCAGCACATCAACACCCTGCTGCTGACCGTCCTGTTCCGCTTCATGCGGCCACTGATCGAG
    GAGGGGCACGTCTACCTCTCGCGCCCGCCGCTCTACAAGATCAAGTGGAGCCGGGACCACGTCGAGTACGCCTACTCCGA
    CCGCGAACGCGACACGCTGCTGGAACTGGGCCGTCGGGACGGCCGCAGGGTCAGGGACGACTCCATCCAGCGCTTCAAGG
    GCCTCGGCGAGATGAACGCCGAGGAACTGCGCGTCACCACCATGGACCCCGACCACCGGGTGCTGGGGCGGGTCGCCCTC
    GACGACGCGGCCGTCGCCGACGACCTCTTCTCGGTTCTGATGGGTGAGGACGTGGAAGCCCGCCGCCACTTCATCCAGCG
    CAACGCCAAGGACGTCCGCTTCCTCGACATCTGA