Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

GADE

The GADE group of genes confer resistance to Acid resistance through the mechanism, Acid resistance regulator.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Acid resistance regulator

    Sequences

    Download Sequences

    >>MEG_3080|Biocides|Acid_resistance|Acid_resistance_regulator|GADE
    ATGATTTTTCTCATGACGAAAGATTCTTTTCTTTTACAGGGCTTTTGGCAGTTGAAAGATAATCACGAAATGATAAAAAT
    CAATTCCCTGTCAGAGATCAAAAAAGTAGGCAATAAACCCTTCAAGGTTATCATTGATACCTATCACAATCATATCCTTG
    ATGAAGAAGCGATTAAATTTCTGGAGAAATTAGATGCCGAGAGAATTATTGTTTTGGCACCTTATCACATCAGTAAACTA
    AAAGCTAAAGCGCCTATTTATTTTGTTAGCCGCAAAGAAAGTATCAAAAATCTTCTTGAGATTACTTATGGTAAACACTT
    GCCCCATAAGAATTCACAATTATGTTTTTCACATAATCAGTTCAAAATTATGCAACTGATTCTGAAAAATAAAAATGAAA
    GCAATATCACGTCGACGCTCAATATTTCGCAACAAACATTAAAGATTCAGAAATTCAACATTATGTACAAGCTGAAACTA
    AGACGTATGAGCGACATCGTCACCCTGGGTATCACATCTTATTTTTAG